1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
adoni [48]
3 years ago
6

If i have a 15 question test and the test is worth 25 points how many points is each question worth

Mathematics
1 answer:
marta [7]3 years ago
5 0
1 point because 15 goes into 25 one time.
You might be interested in
William works at a nearby electronics store. He makes a commission of 6% percent on everything he sells. If he sells a computer
Naddika [18.5K]

Commission earned by William is $ 45.84

<h3><u>Solution:</u></h3>

Given that,

William makes a commission of 6% percent on everything he sells

He sells a computer for $764.00

<em><u>To find: Commission amount of William</u></em>

Given that he makes a commission of 6 % on everything he sells. So he has received a commission of 6 % of $ 764.00

Commission amount of William = 6 % of $ 764.00

a % of b can be written in fraction as \frac{a}{100} \times b

6 \% \text { of } 764=\frac{6}{100} \times 764=0.06 \times 764=45.84

Thus commission earned by William is $ 45.84

8 0
3 years ago
If the sales tax rate is 7.25% in California, then how much tax should a merchant charge in San Francisco for the sale of a $15
Semmy [17]
$15 x .0725 = 1.0875 which we have to round to $1.09
Notice how I changed the  7.25% to a decimal .0725 by moving it back two places.
7 0
3 years ago
Read 2 more answers
A rectangular garden has a length of 20 yards and a width of 42 yards. A diagonal path runs from one end of the garden to the ot
Marta_Voda [28]
Answer: 46.5 yards
*the answer may be C since it's the closest*

Explanation: With a diagonal in the rectangle it creates a triangle so you can use the Pythagorean Theorem to solve the problem.

3 0
3 years ago
Samantha can complete her homework in 3/5 of an hour her brother can complete it in 5/6 of that time what part of an hour does i
s2008m [1.1K]
I think it takes her brother 30 minutes to complete his homework.

Because 3/5 of an hour is 36/60

5/6 = 30/36

Hope this helps! :)
4 0
3 years ago
The diagram shows a regular pentagon
Triss [41]

Answer:

a = 540°

b= 180°

Step-by-step explanation:

a= pentagon has 5 sides which means 180 × 5= 540

b= 540÷5=180

5 0
3 years ago
Other questions:
  • Please help. I really need help with this so please help.
    11·1 answer
  • Round 141.999 to the nearest tenth, hundredth Ten and hundred
    15·2 answers
  • Calculate the simple interest paid on a loan of $544 at 3% for three months.
    14·1 answer
  • Felicia brought three bottles of apple juice and needs to split it between evenly into two cups. What fraction of a bottle will
    11·2 answers
  • Please help!!!!!!
    12·1 answer
  • The Akashi-Kaikyo bridge in Japan is about 1 4/9 as long as the Golden Gate Bridge in San Francisco. The Golden Gate Bridge is a
    11·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • 546/5 it is hard it i
    6·2 answers
  • Find the measure of the missing sides of the triangle if each missing angle is 45°
    14·1 answer
  • HELP PLZZZZZZZZZZZZZZ
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!