1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elena-2011 [213]
3 years ago
7

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

Mathematics
2 answers:
Papessa [141]3 years ago
8 0

Answer:

AATTGGCCATGCATGATTACGA

TTAACCGGTACGTACTAATGCT

Step-by-step explanation:

A's and T's, C's and G's. Just switch the letters for their partner.

solniwko [45]3 years ago
7 0

Answer:

AATTGGCCATGCATGATTACGA- original DNA strand

TTAACCGGTACGTACTAATGCT- complementary DNA strand

You might be interested in
Sam took a total of 12 tests over the course of 6 weeeks if the continued to take tests at the same rate how many tests will Sam
avanturin [10]

Answer:

56 tests

Step-by-step explanation:

first find the amount of test he took each week. if we divide 12 by 6 (12 ÷ 6 = 2) we find out that he took 2 tests per week.

So if he continues with the same rate for the next 28 weeks of school, in order to find out how many tests he would have taken, we just need to  multiply 28 by 2 (28 × 2 = 56), which will be equal to 56

hope this helps! if you have any questions, let me know!

7 0
3 years ago
I need answer please
guapka [62]

Answer:

an answer for what? This one doesn't have a question

4 0
4 years ago
Tickets for a Texans game are on sale. Children, adult, and a senior admission
WARRIOR [948]

Answer:

Step-by-step explanation:

EQUATION - a statement that the values of two mathematical expressions are equal (indicated by the sign =)

Just write down how you would figure out the cost per game.  

first game is 7 people times $8.50 =

and so on

This word problem is a great example of needing to pull out only information you need and ignoring the rest.

6 0
4 years ago
Abigail colors 80% of the total shapes on her paper. She colors 36 shapes. Enter the number of shapes on Abigail's paper.
mestny [16]

Answer:

Step-by-step explanation:

We can set up the following equation:

\frac{80}{100} = \frac{36}{N}

where N is the total number of shapes on Abigail's paper.

Let's first multiply both sides by N:

\frac{80N}{100} = 36

Next, let's multiply both sides by 100:

80N = 3600

Finally, let's divide both sides by 80:

N = 45

3 0
3 years ago
Factor the following polynomial completely 30y^6+25y^5-10y^4
tia_tia [17]
5y^4 * (6y^2 + 5y-2)
3 0
4 years ago
Other questions:
  • How should I write this as an equation and how is the answer 1:15 am?
    6·1 answer
  • Calculate the slope of (59,60) and (53,51) using the formula Y=mx+b
    15·1 answer
  • find the volume of the sphere. either enter an exact answer in terms of pi or use 3.14 for pi and round your final answer to the
    15·1 answer
  • Just question 6 i keep getting the same answer that is wrong
    8·1 answer
  • PLEASE HELPPPPPPP!!!!!!
    13·2 answers
  • Please help me I don't understand
    11·1 answer
  • Find the area of a circle with a diameter of 6.
    14·1 answer
  • A regular hexagon is shown.
    11·2 answers
  • Which equation is linear?<br><br><br> HELP
    9·1 answer
  • What is the the answer to 3{2b+4} + 12b +6= 54
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!