1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elena-2011 [213]
3 years ago
7

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

Mathematics
2 answers:
Papessa [141]3 years ago
8 0

Answer:

AATTGGCCATGCATGATTACGA

TTAACCGGTACGTACTAATGCT

Step-by-step explanation:

A's and T's, C's and G's. Just switch the letters for their partner.

solniwko [45]3 years ago
7 0

Answer:

AATTGGCCATGCATGATTACGA- original DNA strand

TTAACCGGTACGTACTAATGCT- complementary DNA strand

You might be interested in
Rob has 10 white, 8 red and 6 blue socks in his drawer. if he selects socks from the drawer randomly, without looking, what is t
s344n2d4d5 [400]
The least number of socks that rob can remove to guarantee he removed a pair of white socks without looking is15 socks
5 0
3 years ago
PLEASE HELP!!! GIVING BRAINLIEST!! ill also answer questions that you have posted if you answer this correctly!!!! (80pts)
Valentin [98]

Answer:

I think its 57

Step-by-step explanation:

the difference of 6 divided by 2 is 3

i just divided 171 by 3 and got 57

3 0
3 years ago
Read 2 more answers
The graph shows the amount of money paid when purchasing bags of peanuts at the zoo:
Mumz [18]
The constant of proportionality would be "4"  ... proportional relationships are in the form of y = kx..  so in your ordered pairs, you can see that to get the 'y' coordinates you would have to multiply the 'x' coordinates by 4.
5 0
3 years ago
Read 2 more answers
Solve 15 = 0.5 n check the souution
denis23 [38]
N = 30.

0.5(30) = 15
8 0
3 years ago
Write an expression for the sequence of operations described below.
Rainbow [258]

Answer:

A+B=C. C/6=D

Step-by-step explanation:

7 0
3 years ago
Other questions:
  • Gina wants to go to the water park with her friends. They have a total of www dollars to buy 555 tickets. Each ticket costs 1515
    14·2 answers
  • What is 50= 28.10 + 0.15m
    6·1 answer
  • Clark and Lana take a 30-year home mortgage of $128,000 at 7.8%, compounded monthly. They make their regular monthly payments fo
    9·1 answer
  • Is 7.6157731 irrational
    13·1 answer
  • Write an equation of the line parallel to 3x+y=7 that goes from (-3,5) in slope intercept form.
    12·1 answer
  • Erick went bowling, and after 4 sets, his scores were: 120, 96, 85 and 105. His total after 5 sets were 525. What was his score
    10·1 answer
  • Write an equation in slope-intercept form of the line that bisects the angle formed by BA and BC
    9·1 answer
  • The drawing plan for an art studio shows a rectangle that is 17.2 inches by 6 inches. The scale in the plan is 2 in.: 5 ft. Find
    9·1 answer
  • Im 13 and 2 months years old and im 5'2 my brothers 5'11 and my mothers 4'11 how tall will i be
    11·1 answer
  • HELPPPPPPPPPP!!!!!!!!!!!!!
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!