1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elena-2011 [213]
3 years ago
7

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

Mathematics
2 answers:
Papessa [141]3 years ago
8 0

Answer:

AATTGGCCATGCATGATTACGA

TTAACCGGTACGTACTAATGCT

Step-by-step explanation:

A's and T's, C's and G's. Just switch the letters for their partner.

solniwko [45]3 years ago
7 0

Answer:

AATTGGCCATGCATGATTACGA- original DNA strand

TTAACCGGTACGTACTAATGCT- complementary DNA strand

You might be interested in
Please help me do this i’ll give brainlist and points
lorasvet [3.4K]

To make enough brew for 4 people you would need:

3 frogs

4 1/2 cups of sour milk

14 gerbil tails

52 crickets

2/3 cup of eyeballs

2 Twinkies

<em>Have a luvely day!</em>

3 0
2 years ago
Can any one help me with this problem ​
AnnyKZ [126]
A - 2
B - 4
C - 3
D - 1
3 0
3 years ago
What is the volume of the prism?
asambeis [7]
4 1/2
Try Cymath it’s great for this stuff
6 0
3 years ago
Read 2 more answers
Which number is closest to 1/2
noname [10]

Answer:

0.56

it's basically the number closest to 50. Don't get tricked by the 0.05 because that's only 5% not 50%

8 0
2 years ago
11x+16y=13 solve for y
suter [353]

11x+16y = 13

16y = -11x+13

y = -11/16x+13/16

3 0
3 years ago
Other questions:
  • Simplify [2 × (10 5)] - 5 Question 4 options: 25 20 12.5 120
    9·1 answer
  • Write in scientific notation<br> 9,870,000,000,000,000
    10·1 answer
  • Kalvin sells bottles of water at baseball games
    5·1 answer
  • 1. 6:8
    6·1 answer
  • In ΔTUV, v = 87 inches, t = 12 inches and ∠U=112°. Find the length of u, to the nearest inch.
    5·1 answer
  • Questions 2 &amp; 3 FAST PLS ITS A TEST! WILL GIVE BRAINLIEST!
    9·1 answer
  • How is the following written with only one exponent?<br>a^3 . a^5​
    6·1 answer
  • Simplify (2a⁵ b3/a³ a-²)3
    14·1 answer
  • What is the inverse function? Can any math experts help please
    8·2 answers
  • ...................................................
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!