What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
2 answers:
You might be interested in
To set the equation,we can first find how much price would be raised within a year:
=500×(1+7%)
=500×1.07
As the years go by the increase would accumulate,and the equation would be:
Hope it helps!
=500×(1+7%)
=500×1.07
As the years go by the increase would accumulate,and the equation would be:
Hope it helps!