1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elena-2011 [213]
3 years ago
7

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

Mathematics
2 answers:
Papessa [141]3 years ago
8 0

Answer:

AATTGGCCATGCATGATTACGA

TTAACCGGTACGTACTAATGCT

Step-by-step explanation:

A's and T's, C's and G's. Just switch the letters for their partner.

solniwko [45]3 years ago
7 0

Answer:

AATTGGCCATGCATGATTACGA- original DNA strand

TTAACCGGTACGTACTAATGCT- complementary DNA strand

You might be interested in
Estimate by rounding 642÷83
Sunny_sXe [5.5K]

8

round each number to the nearest 10, then

640 ÷ 80 = 8 ← estimate


5 0
3 years ago
Which diagram matches the equation or description.
marissa [1.9K]

I believe the answer to this diagram should be <u><em>Diagram B</em></u>

4 0
3 years ago
Rodney is making three pizzas. The recipe says that, for one pizza, he needs 2 cups of flour, 2 teaspoons of instant active dry
Mamont248 [21]

Answer:

14 cups of flour.

Step-by-step explanation:

Rodney is making three pizzas.

The recipe says that for one pizza he needs flour = 2 cups

Rodney buy a bag of flour containing = 20 cups flour

Rodney needs flour for three pizzas = 3 × 2 = 6 cups

He will have left over flour after making the pizzas = 20 - 6

                                                                        = 14 cups of flour.

Rodney will have left over 14 cups of flour after making the pizzas.

6 0
3 years ago
The sum of 9 and twice a number
Marrrta [24]
9 + n = x ?
i'm guessing since there's no answer to what the sum is
4 0
3 years ago
The first three towers in a sequence are shown. The nth tower is formed by stacking n blocks on top of an n times n square of bl
erik [133]

Answer:

The 99th tower contains 9900 blocks.

Step-by-step explanation:

From the question given, we were told that the nth tower is formed by stacking n blocks on top of an n times n square of blocks. This implies that the number of blocks in n tower will be:

n + n²

Now let us use the diagram to validate the idea.

Tower 1:

n = 1

Number of blocks = 1 + 1² = 2

Tower 2:

Number of blocks = 2 + 2² = 6

Tower 3:

Number of blocks = 3 + 3² = 12

Using same idea, we can obtain the number of blocks in the 99th tower as follow:

Tower 99:

n = 99

Number of blocks = 99 + 99² = 9900

Therefore, the 99th tower contains 9900 blocks.

7 0
3 years ago
Other questions:
  • Find all factor pairs for 9
    14·1 answer
  • Jane arranges m chairs in each of n rows to seat x people.
    13·1 answer
  • What is the surface area of the right cone below?
    5·1 answer
  • Write as a monomial in standard form (−4x^2ya^3)^2
    15·2 answers
  • What is the approximate length of the diameter, d? *
    14·2 answers
  • Factor Completely<br> 40t - 16<br> Enter your anwser in the boxes.<br> Halp plz
    9·2 answers
  • What is 4 nickels to 2 dollars
    14·2 answers
  • Help pls appreciate it pls
    9·1 answer
  • What is 3 tenths plus 8 tenths?
    5·2 answers
  • true or false. a dialation with a negative scale factor has the center of dialation between the pre-image and image
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!