What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
2 answers:
You might be interested in
Answer:
22-18-25,
19-24-30,
7-24-25
Step-by-step explanation:
In a triangle with side lengths ,
, and
, any two sides must have a sum larger than the third.
Using this rule, the possible side lengths out of these choices that could form a triangle are:
22-18-25,
19-24-30,
7-24-25
Answer:
The correct option is A.
Step-by-step explanation:
The given number is
Where 5 is dividend and 11 is divisor.
Since dividend is less than divisor we add a decimal place and the first zero. Notice the decimal point which has appeared on the answer line and by the dividend. It does not appear anywhere else.
Now the dividend is 50. Divide the number by divisor.
Subtract 44 from 50.
Therefore remainder is 6. Place a zero after 6.
Now the new dividend is 60. Divide the number by divisor.
Subtract 55 from 60.
Therefore remainder is 5.
Therefore option A is correct.
