1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
larisa86 [58]
3 years ago
9

What is the significance of secondary growth in plants?

Biology
2 answers:
kipiarov [429]3 years ago
4 0
The correct answer is A. 
Secondary growth in plants allows many woody and non woody plants to grow tall and strong. The growth basically occurs in the roots and the stems and it is controlled by lateral meristem.  Examples of non woody plants that undergo secondary growth include: carrot, potato, tuber, etc.<span />
Tanya [424]3 years ago
4 0
The growth starts from the roots and them to other parts. So the significance of secondary growth in plants is To support the extra weight of the tree due to an increase in its height and to prevent it from collapsing. So the answer to your question is letter A.
You might be interested in
What does a plant need to create a glucose molecule in photosynthesis?
Rina8888 [55]

Carbon dioxide and oxygen.

8 0
2 years ago
Read 2 more answers
Semen contains all of the following, EXCEPT
kap26 [50]

Answer: C. Clotting enzyme

Explanation:

Semen is the fluid that is discharged by the male reproductive organs. It is composed of sperms and viscous fluid to facilitate the flow of sperms to the female genital tract. It consists of fluids secreted from various glands. The seminal vesicles secrete about 70% of the semen. It consists of fructose. The prostrate gland secrete about 20% volume of the semen. The fluid consists of acid phosphatase, and proteolytic enzymes. The bulbourethral gland secretes about 5% of the total volume of semen. It consists of mucoproteins.

The clotting factors or enzymes are absent in semen as these are produced by the blood platelets at the site of injury.

8 0
4 years ago
Hola como estan soy nueva
alukav5142 [94]

Answer:

Buena gracias

Explanation:

4 0
3 years ago
What happens at a transform fault?
Mariulka [41]
Answer is D. because they move relative to each other
6 0
3 years ago
The bones of the fingers and toes (phalanges) are categorized as _____ bones.
ch4aika [34]

Answer: long

<span>The bones are classified into 5 types according to their shapes: long, irregular, short, flat or sesamoid. The phalanges (bones of the fingers and toes) are classified as long bones, meaning they are longer than they are wide. </span>

6 0
3 years ago
Other questions:
  • Is the law of inertia and Newton’s first law mean exactly the same thing
    14·1 answer
  • What are genetic mutations
    11·1 answer
  • Giving 30 points!Is water wet? Or moist?
    6·2 answers
  • During a natural disaster, part of a plant was damaged. If the plant can no longer grow, and produce new root cells, which part
    8·2 answers
  • __________ are a proposed solution to enhance species survival by effectively creating a large preserve from several smaller one
    10·1 answer
  • What is the carbon in CO2 used to make
    7·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • What is the definition of meteor
    6·1 answer
  • During a frog's life, it makes a transformation from its "baby form" (an aquatic tadpole) to its adult form, which looks very di
    9·1 answer
  • A cross between a white horse and a brown horse produces offspring that are golden in color. The possible
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!