1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ilya [14]
4 years ago
7

What two factors determine the shape of a protein

Biology
2 answers:
liubo4ka [24]4 years ago
8 0
Determined by its primary structure (sequence of amino acids.)

the sequence of amino acids in an protein is determined by the nucleotides in the DNA encoding it
neonofarm [45]4 years ago
3 0
The structure is 1 i know
You might be interested in
What process causes dissolved substances to be left behind to form minerals after water in lakes or ponds evaporates?
Mkey [24]
<span>A. precipitation  is the process</span>
3 0
3 years ago
Read 2 more answers
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
Use the passage to answer the following question.
alekssr [168]
The answer is A, anti-fungal drugs.

According to the passage, "but if the problem persists, see a doctor who can prescribe anti-fungal drugs". In additional, at the beginning of the passage, it already stated that athlete's foot is caused by a fungus, so we can sure that the answer is A.
6 0
3 years ago
After a natural disaster such as a hurricane or a drought a population
GREYUIT [131]
After A Natural Disaster , Population Usually Decreases Due To Death Or People Fleeing From Their Home .
3 0
3 years ago
Imagine yourself in a dark classroom reading PowerPoint slides. If an audience member were to check the internet using her cell
Arturiano [62]
The answer is Weber's law
6 0
3 years ago
Read 2 more answers
Other questions:
  • What is the age of a meteorite if potassium-40 decayed from 80 g to 10 g? The half-life of potassium-40 is 1.3 billion years. 1.
    15·2 answers
  • A 37-year-old semiconscious male sustained a stab wound lateral to the left side of the sternum. he presents with signs of shock
    9·1 answer
  • if a homozygous dominant parent and a heterozygous parent are crossed, what percentage of the offspring are expected to heterozy
    9·1 answer
  • Neurotransmitters Select one: a. stimulate presynaptic terminals. b. remain in the synaptic cleft for long periods of time. c. b
    12·1 answer
  • Please please help me <br> !!!!!!!!!
    7·1 answer
  • Tropical rain forests receive heavy rainfall. How do the trees and plants of this region withstand rotting?
    13·1 answer
  • Elijah is preparing for a test on animal cycles. he needs to remember how some animals go through metamorphoses. which animal wo
    13·2 answers
  • Which of the following scientists made major contributions to cell theory?
    12·1 answer
  • In fruit flies long wings are a dominant trait and short wings are recessive trait Two fruit flies that are heterozygous for the
    6·1 answer
  • Respiration takes place in:
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!