1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
blagie [28]
4 years ago
12

Have both a significant hydrophilic region and a significant hydrophobic region.

Biology
1 answer:
mario62 [17]4 years ago
7 0
Phospholipids have two distinct polarities. The phosphate head is always polar, while the two "tails" it has are nonpolar.
You might be interested in
Each of the following processes is associated with one or more specific eukaryotic organelles. In each case, identify the organe
Kisachek [45]

Answer:

Part A It is associated with peroxisomes and mitochondria.

Part B. It is associated with smooth endoplasmatic reticulum.

Explanation:

The oxidation of long chain fatty acids are produced at the beginning in the mitochondria, it is called B oxidation because there is a carbon in this position that in this process is going to be oxidized to a carbonyl group. The very long fatty acid chains are also oxidized in the peroxisomes.

The cholesterol biosynthesis is made inside the hepatic cells, in the endoplasmatic reticulum. Is a process that starts with acetyl Coenzime A that was oxidized in the mitochondria. This process is regulated by the intake of cholesterol from the diet.

Hope this info is useful.

5 0
3 years ago
Choose all that explain why carbon is so important to life.
elena-s [515]

Answer:

A, C and D

Explanation:

It creates no ionic bonds because it would need certain changes to it.

Im not so sure about E because the configurations are very similar.

And A seems to make sense because its essential to life itself.

4 0
4 years ago
What was the Renaissance?
enot [183]

Answer:

A. "Rebirth" of thinking

Explanation:

7 0
3 years ago
Using darwins observations, explain how zebras got their stripes
Oksana_A [137]

I believe it has something to deal with helping the zebras adapt to their surroundings.

Darwins observations explain that zebras have stripes to adapt to their surroundings.

8 0
3 years ago
Read 2 more answers
What time frame best describes when earthquakes occur?
snow_tiger [21]

Answer:

D

Explanation:

it mostly occurs quarterly

4 0
3 years ago
Other questions:
  • Paraphrase four safety practices you should always use when you begin scientific inquiry
    5·1 answer
  • Any change or random error in a DNA sequence
    7·1 answer
  • As the organism inside the respirometer consumes oxygen what happens to the water
    14·2 answers
  • Will give 55pts
    10·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Define: resistance (R)
    6·1 answer
  • 1.
    9·1 answer
  • How can an artificial reef be considered favorable effect of building a plane?
    8·1 answer
  • if there are 80 grams of sodium hydroxide, 44 grams of water, and 62 grams of sodium sulfate, then how many grams of sulfuric ac
    8·1 answer
  • What proportion of the resulting offspring is expected to be male with barred feathers and a pea comb
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!