1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nat2105 [25]
3 years ago
10

The administration method that takes the longest time for the drug to reach the brain is __________.

Biology
1 answer:
photoshop1234 [79]3 years ago
4 0

Oral ingestion or swallowing is the administration method that takes the longest time for the drug to reach the brain. When using this method, the drug is swallowed through the mouth, moves to the stomach and then into the bloodstream before it can be transported to the brain. This means that it takes longer for a swallowed drug to start functioning than it does with other methods of administration such as injecting.






You might be interested in
During elimination training the positive reinforcement should be given ___ after the proper behavior is exhibited?
MArishka [77]
The answer is only for the blank above
5 0
3 years ago
Read 3 more answers
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
A farmer is being troubled by coyotes eating his sheep. in an attempt to solve the problem, he kills a sheep and laces its body
Misha Larkins [42]
The farmer is attempting to apply the principle of conditioned taste aversions to accomplish his objectives. Conditioned taste aversion occurs when an animal associates the taste of a certain food with symptoms caused by a toxic, spoiled, or poisonous substance. Generally, taste aversion is developed after ingestion of food that causes nausea, sickness, or vomiting.Tate aversions is an important principle that help us better understand animals and people tend to form one pairing associations between a certain stimuli, unlike other classical conditioning examples, for it one eats a food and becomes ill, he or she is predisposed to avoid the substance.
7 0
3 years ago
How does water enter the atmosphere? a. Liquid water evaporates from lakes when heated by the sun. b. Frozen water sublimates fr
Alecsey [184]
Your answer is
D. all of the above
5 0
3 years ago
Read 2 more answers
Does anybody know this?
marishachu [46]
We can’t see what you’re talking about :( there’s no image or anything on my end
3 0
3 years ago
Read 2 more answers
Other questions:
  • Mrs. Jones is exposed to high-energy solar radiation. She develops skin cancer as a result of a mutation in skin cells. A physic
    6·1 answer
  • Mary's doctor says that her inactive lifestyle has put her at risk of becoming obese. What else might Mary be facing if she cont
    15·2 answers
  • 1.) Which of the following is an electron carrier used to transfer energy in cellular respiration?
    15·1 answer
  • Which of the following is NOT a nitrogen base found DNA?
    12·2 answers
  • Which feature of a cell membrane determines whether molecules can cross<br> the membrane?
    12·1 answer
  • 3. The evolutionary pathways of ten different species are represented in the diagram below.
    14·1 answer
  • Oping
    10·1 answer
  • Do sex cells have homologous chromosomes
    7·1 answer
  • State two changes which take place in the flower after pollination​
    8·1 answer
  • What are the values in biological education ​
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!