1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
love history [14]
3 years ago
11

Explain how human embryonic stem cells, adult stem cells, and skin cells taken from the same person would be the same and how th

ey would be different. Explain what causes the differences you describe.
Biology
1 answer:
nexus9112 [7]3 years ago
8 0
All three cells would be similar since they all share the same hysteroscopic pathology being that they are all from the same individual. However, the ways in which they are different are vast and can be described ad nauseam. Suffice it to say that an embryonic stem cell is the most pure form of a cell, and can be used in a variety of different stem cell therapies for that reason. The skin cells would be most useful in terms of skin grafts, while adult stem cells are found only in mature individuals (ie: adults) and have little purpose other than supplying the organism with energy storage capacities.The differences briefly described here are due, in large part, to the tenets of the cell theory which states that all organisms, whether single celled or otherwise, are comprised of one or more cells containing DNA. 
You might be interested in
Color blindness is a sex-linked recessive trait. A mother with normal color vision and a color blind father have a color blind d
Serhud [2]
Color blindness is X linked trait and is carried on X chromosome so when a <span> A mother with normal color vision and a color blind father have a color blind daughter the offspring will be
</span><span>. Some of their sons can have normal color vision 
</span>because male is XY and female XX
so i conclude option B is correct<span />
7 0
3 years ago
Read 2 more answers
What is an example of selective breeding
Rudiy27
An example of selective breeding is breeding cattle to produce better meat.
3 0
3 years ago
Read 2 more answers
This is the question i need help with<br> select all that applies
Genrish500 [490]
3rd and 4th awnsers are correct
4 0
2 years ago
I need help on this please help
777dan777 [17]

dna, genes, animo, to acids

8 0
3 years ago
enzymes affect the reaction in a living thing by changing the activation energy and ___________- up the reaction
Alja [10]
Speeding up the reaction
4 0
3 years ago
Other questions:
  • Of what mineral or minerals is the sandstone made
    14·2 answers
  • What type of microscope would be best to view a piece of moldy bread? Explain
    15·2 answers
  • Which phase of cell division is shown?
    15·2 answers
  • Gonorrhea is transmitted by ____. 1. contact with blood and body fluids 2. coughing or sneezing (droplet or aerosol) 3. mucous m
    11·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • A wave with a frequency of 0.5 Hz and a speed of 10 m/s has a wavelength of a. 50 m. c. 20 m. b. 0.5 m. d. 0.2 m. Please select
    13·1 answer
  • Can someone help me please
    11·1 answer
  • Match the reactants and products with the correct HALF of PSN.
    9·1 answer
  • Consider two ocean waves A and B. A has an amplitude of 5 Units and B has an amplitude of 12 units. Compare their energy
    13·1 answer
  • the following statement: "it [the canal] was justly hailed as an enterprise of breathtaking boldness" is what? A. an opinion Bpe
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!