1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nonamiya [84]
4 years ago
8

Regulatory secretion of hormones would be associated with ________ at the transface of the Golgi.a. endosomes b. lysosomes c. cl

athrin-coated vesicles d. non-clathrin vesicles e. microsomes
Biology
1 answer:
Marysya12 [62]4 years ago
7 0
<h2>c) is the correct option </h2>

Explanation:

  • All vesicles which are involved in protein targeting are protein coated that assemble on cytosolic surface
  • Clathrin coated vesicles are those types of vesicles which are involved in both retrograde as well as anterograde transportation
  • Retrograde transportation is the one where transportation occurs from Golgi to Endoplasmic Reticulum whereas Anterograde transportation is the one which involves transportation from Endoplasmic Reticulum to Golgi
  • Vesicles originated from either Trans Golgi Network or plasma membrane and fuse with either lysosomes or plasma membrane
  • Proteins transportation occurs from Trans Golgi Network to lysosomes, Trans Golgi Network plasma membrane and from plasma membrane to endosome

You might be interested in
After receiving a stimulus, the _____ send(s) signals to the appropriate area of the body.
Natasha_Volkova [10]
After receiving a stimus, the sensory receptors send(s) signals to the appropriate area of the body.

the must be sensory neurons.

hope its help..

--erjayU

7 0
3 years ago
Read 2 more answers
What is humidity. A: the amount of water vapor per a unit of air. B: the amount of water vapor in the air at a given time and pl
Sveta_85 [38]

the answer is A hope this helps.

5 0
3 years ago
Read 2 more answers
The classification system includes the domain Archaea. What characteristic would NOT be found in an organism in this domain? A.
statuscvo [17]

Answer:

A. A cell wall

Explanation:

The organism found in this domain is bacteria. Bacteria do not have cell walls. This is why we take anti-biotics, they attack the cell membrane of the bad bacteria since they have no wall to protect themselves

3 0
3 years ago
The two types of tides are _____ tide and _____ tide.
Neko [114]

Answer:

B. high; low

Explanation:

Every six hours, The tide changes from high tide to low tide

3 0
3 years ago
Read 2 more answers
How many millimeters of water are equivalent to 1000 grams
tigry1 [53]

Answer:

1000 ml

Explanation:

is the answer of your question

4 0
3 years ago
Other questions:
  • Projections from the cell that move materials and mucus are:
    9·1 answer
  • Mr. Casa wants to put a fence around a circular
    9·1 answer
  • What characteristic of life best describes the process of photosynthesis?
    15·1 answer
  • Why is California’s high-speed rail such a groundbreaking effort
    10·1 answer
  • Johann maintains a $75,000 insurance policy on his boat. He pays $50 per month in premiums and his deductible is $2,500. If he i
    5·2 answers
  • 10.1 Limits To Cell Growth
    11·1 answer
  • Tall is dominant. If these two parents were to produce 50 offspring, what percentage would have the genetic makeup to be tall
    15·1 answer
  • Who is a famous black person who is alive
    8·2 answers
  • Which of the labeled structures is an adaptation that is primarily responsible for helping a paramecium control its water balanc
    9·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!