1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Solnce55 [7]
3 years ago
13

A key difference between green algae and land based plants is that

Biology
1 answer:
PolarNik [594]3 years ago
5 0

Answer:

Green Algae can either be unicellular ( single-celled) or multi-cellular while land bases plants are typically multi-cellular organisms ( made up of many cells)

Explanation:

A key difference between green algae and land based plants is that; while plants are typically multi-cellular organisms, Algae can either be unicellular     ( single-celled) or multi-cellular.

Thus the key difference between green algae and land based plants is their complexity. Algae are simple organisms while plants are complex, with several specialized structures.

You might be interested in
Why are the geochemical and biogeochemical cycles so important? A.Keeps volcanoes from erupting so often. B.Maintains oil deposi
AleksAgata [21]
C) would be the answer. I just did a test w/ this question and I picked C) and got !00%
4 0
3 years ago
Read 2 more answers
Dr. Han is studying which brain structure is associated with aggressive behavior among rats. Which part of the brain is she like
djyliett [7]

Answer:

The correct answer is - The amygdala

Explanation:

The amygdala is the part of the brain that is found in the medial temporal lobe of the brain. It is an almond-shaped structure of neurons. The amygdala is an essential region of the brain that has a major role in processing emotions such as aggression and others. It is the region of the limbic system that presents both sides of the brain.

Thus, the correct answer is - the amygdala.

7 0
2 years ago
In winter, although many parts of Europe have heavy snow falls, the sea ports remain ice-free and ships come and go. What could
son4ous [18]

The answer is (A. A warm current flows along the coast.) Currents carry cold and warm water from place to place. It's an amazing phenomenon that scientists are still trying to fully figure out.  Some think it's caused by wind, others think it's caused by the shifting of the tectonic plates, but one thing's for sure, currents are VITAL for this planets life.

8 0
3 years ago
Read 2 more answers
The mitotic phase of the cell cycle is the combination of mitosis and what other process?
professor190 [17]

Answer:

the cell cycle

Explanation:

Image of the cell cycle. Interphase is composed of G1 phase (cell growth), followed by S phase (DNA synthesis), followed by G2 phase (cell growth). At the end of interphase comes the mitotic phase, which is made up of mitosis and cytokinesis and leads to the formation of two daughter cells.

5 0
3 years ago
Read 2 more answers
Help plz:
otez555 [7]

Answer:

Most invertebrates (and higher animals) can be placed in one of two groups based on how they develop as embryos. The two groups are called protostomes and deuterostomes. ... It shows that echinoderms are more closely related to chordates than are the other invertebrate phyla. Explanation:

3 0
2 years ago
Read 2 more answers
Other questions:
  • How do you species that fill the same niche as each other survive in ecosystems?
    5·2 answers
  • What are the spacial features of Granite igneous rock
    12·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • The sum of all the chemical reactions carried out in an organism is called
    5·1 answer
  • What holds the base pairs of DNA together? A. Covalent bonding B. Double helix C. Ionic bonding D. Hydrogen bonding
    7·1 answer
  • Sharks and other predators do not normally eat plants however they do receive some energy from plants how is this possible
    6·1 answer
  • Describe the structure of the cell membrane. Where is this membrane made?
    9·1 answer
  • Write 16 facts about the carbon cycle
    5·1 answer
  • Post Test
    13·1 answer
  • I need help please!!
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!