1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nirvana33 [79]
4 years ago
6

Quantitative characters vary in a population along a continuum. How do such characters differ from the characters investigated b

y Mendel in his experiments on peas?
A. Environment and genes affect quantitative characters, whereas only genes determined the pea characters studied by Mendel.
B. The nature of inheritance of quantitative characters is poorly understood, and Mendel understood the nature of inheritance for the characters he studied in his peas.
C. Quantitative characters are due to polygenic inheritance, the additive effects of two or more genes on a single phenotypic character.
D. A single gene affected all but one of the pea characters studied by Mendel.
Biology
1 answer:
erik [133]4 years ago
8 0

Answer:

C. Quantitative characters are due to polygenic inheritance, the additive effects of two or more genes on a single phenotypic character.

Explanation:

Mendel studied the discrete traits that were present in observable contrasting phenotypes. Tall or dwarf stem, purple or white flowers, round or wrinkled pods are some of the examples of discrete traits. Each of these traits is mostly regulated by two alleles of a gene.

On the other hand, a polygenic trait is the one that is regulated by more than one gene. Quantitative traits are polygenic traits. The alleles of all the genes that regulate a quantitative trait have an additive effect on the phenotype. For example, human skin color is a quantitative trait and shows continuous variation. There is a range of human skin color regulated by the sum total of effects of all the alleles of the regulatory genes present in an individual.

An individual with "aabbcc" genotype would have very light skin color while an individual with "AABBCC" genotype would have a very dark skin color. The skin color of the intermediate genotype would be in between these two extreme phenotypes.

You might be interested in
A recessive allele is usually represented by
kogti [31]

Answer:

Recessive alleles are usually represented by lowercase letters and require two copies to be expressed

Explanation:

5 0
4 years ago
Read 2 more answers
Some of the components of the blood of a mammal are listed. Which two of these components are involved in attacking bacteria and
aniked [119]
The answer is 1 and 4
4 0
3 years ago
Assuming that transcription and translation both proceed from left to right, which is the correct orientation of the DNA templat
aleksklad [387]

The correct answer is:

DNA template 3'– ……… –5'

RNA transcript 5'– ……… –3'

Protein product H2N– ……. –COOH

In nucleic acids, DNA and RNA 5’ end refers to phosphate group attached to the 5′ carbon of the ribose ring, while 3’ end refers to the ribose -OH substituent. Nucleic acids can only be synthesized in the 5′-to-3′ direction, which means that the DNA template is 3’—5’. Translation of the protein by the ribosome will also proceed in a 5′ to 3′ direction, which means that the mRNA template is 3’—5’.

The protein during the synthesis is extend from its N terminus toward its C terminus.

6 0
3 years ago
Which describes the part of Africa below the Equator
Gnom [1K]

Answer:

South Africa

Explanation:

4 0
3 years ago
In this experiment, you are looking at the effect of various germicides on microbial growth. The organism that you are using for
raketka [301]

Answer:

Less susceptible.

Explanation:

This organism would be less susceptible to the various germicides than a prokaryotic organism, such as bacteria because the form and structure of eukaryotic organism is different from the prokaryotic organism so the germicides no or less affected the eukaryotic organism so we can say that the  the eukaryotic organism which is used in baking would be less susceptible to the various germicides than a prokaryotic organism.

8 0
3 years ago
Other questions:
  • A threatened species is likely to have _____ than an endangered species.
    9·2 answers
  • How does gas like oxygen get across the cell membrane?
    10·1 answer
  • Hybrid inviability and hybrid infertility are two examples of:________.
    11·2 answers
  • 100 POINTS! WILL MARK BRAINLIEST!
    10·2 answers
  • Can you help me Did you brainless any science
    5·2 answers
  • The table shows the nature of reactants and products formed in a certain type of chemical reaction.
    5·1 answer
  • ok so my hairs like thick and brown to a lil above my waist should I cut it to my shoulders or keep it or uh like mid length I J
    14·2 answers
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Explain how the biogeochemical cycles obey the law of conservation of matter. Use 1 cycle as specific evidence to support your c
    9·1 answer
  • What most likely happens when a plate under the ocean is forced beneath another plate?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!