1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tamiku [17]
4 years ago
5

A science class is checking to see how much life exists in local streams. One of the students records that 20 amoeba were found

in the first sample of water. What is the student doing?
Biology
2 answers:
wlad13 [49]4 years ago
5 0
Collecting Data
-Apex
Naya [18.7K]4 years ago
4 0
What this student is doing is collecting data. So, he wants to check how many life forms there are in the waters nearby. In order to do so, he has to take a sample, and look at it through a microscope so as to determine the number. So, he collected a sample which is his data. He is not drawing conclusions yet, but rather counting these organisms. He is not making a peer review - his peers aren't even mentioned here. He is not forming a hypothesis because he is just counting at this point.
You might be interested in
Describe the process of natural selection
Keith_Richards [23]
Natural selection is the process in which the more favorable traits due to mutation that are in a select few in a population produce more offspring then others. An example of this is bacteria resistant to antibiotics due to the faster reproduction of the resistant bacteria over the non resistant ones
3 0
3 years ago
Read 2 more answers
Which of the following animals has a broad niche?
stealth61 [152]

Answer:

raccoon

Explain

because raccoons can basically live anywhere and eat anything snowy owls cant live somewhere hot like in California. and I don't know what kind of termites your talking about

6 0
4 years ago
Read 2 more answers
Which organelles make up animal cells? pls i have an assignment in 1 hr
Sati [7]

Answer:

Organelles in animal cells include the nucleus, mitochondria, endoplasmic reticulum, Golgi apparatus, vesicles, and vacuoles

Explanation:

4 0
3 years ago
Which of the following properties of water are essential for life on Earth?​
Viktor [21]

Answer:

Option D

Explanation:

Complete question

which of the following properties of water are essential for life on Earth?​

A) polarity

B) Cohesion & Adhesion

C) High heat capacity

D) All the above

Solution

Some essential properties of water are as follows –  

a) Polarity

b) Solvent

c) High heat capacity - it is essential to maintain the temperature on earth. The water bodies are comparatively cooler than the temperature of earth

d) High heat of vaporization

e) Cohesion – It is essential for surface tension & capillary action

f) Adhesion – It is essential for surface tension & capillary action

g) Lower freezing density – Due to this reason, ice is lighter than water

Hence, option D is correct

7 0
3 years ago
The administration of prepared antibodies, such as those in breast milk, is an example of _____ immunity.
RUDIKE [14]

The administration of prepared antibodies such as those in breast milk is an example of passive immunity.

<h3>What is passive immunity?</h3>

when the prepared antibodies are directly given to protect the body against foreign agents is called passive immunity.

during the initial days of lactation, the yellowish fluid colostrum is secreted by the mother. it contains abundant IgA-prepared antibodies. during breast milk, it contains these antibodies that give immunity to the infant. it fights against the pathogen. these are an example of passive immunity.

To learn about passive immunity refer to        

brainly.com/question/21480961

#SPJ2  

8 0
2 years ago
Other questions:
  • A biologist measures the allele frequencies of pea plants in a very controlled environment. The plants can either have a dominan
    14·2 answers
  • What places are likely to support a large consumer population? A. regions that receive abundant sunlight B. areas that have many
    5·1 answer
  • Cancer is often the result of activation of ________to ________ and the inactivation of _______ genes.
    13·1 answer
  • Final question for reflection: what would you say to someone who says "bacteria are learning how to survive today's antibiotics?
    8·1 answer
  • What is acid base and salt
    13·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • "" what is photosynthesis "'​
    5·1 answer
  • Explain the difference between the offspring of sexual
    8·1 answer
  • what is the relationship between exposing to a virus and developing immunity to it? cite evidence from the text to support your
    10·1 answer
  • What is the cell ? How many champers did have the heart?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!