1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
icang [17]
3 years ago
9

What is the benefit to a society if everyone reduces the amount of meat they eat?

Biology
2 answers:
iren2701 [21]3 years ago
8 0

Answer:

The benefits are related to a decrease in the amount of water that is consumed by cattle raising and a decrease in the amount of methane release to atmosphere.

Explanation:

If everyone reduces the amount of meat they eat, there will be a a decrease in the number of animals destined to cattle raising. Cattle raising needs a big supply of water so, if the quantity of meat produced diminish, the amount of water consumed by this activity will diminish too. At the same time, cattle raising are known to release methane to atmosphere, so this is another benefit for the society.

Paha777 [63]3 years ago
5 0
The benefit to a society if everyone reduces the amount of meat they eat is that it will help the nutrient cycle. It could also reduce the amount of nitrogen going to the environment. Thank you for posting your question. I hope this answer helped you. Let me know if you need more help. 
You might be interested in
Which of the following statements is true regarding DNA?
olasank [31]
I think the correct answer from the choices listed above is option A. DNA contains deoxyribose sugar. DNA stands for deoxyribonucleic acid so it should contain such sugar. It is a molecule that contains genetic material used in organisms and other living things.
6 0
3 years ago
Read 2 more answers
What is the common element found in the human body
juin [17]
Hydrogen and Oxygen. Better known as H2O
6 0
3 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Which characteristics are necessary for a society to be considered a civilization?
jek_recluse [69]

Answer:

The six most important characteristics of a civilization are cities, government, religion, social structure, writing, and arts and architecture.

Explanation:

7 0
3 years ago
Read 2 more answers
explain why it is important to keep the levels of nucleotides relatively balanced in the context of dna and rna synthesis
juin [17]

Answer:

Read Below

Explanation:

Nucleotides are A & T and G&C you see in DNA and in RNA T is Replaced by U. The reason they must be balanced between G&C and T&A is because G has to bond with A in DNA and G with C so if there is more G than C that means there is mismatches between the DNA nucleotides same thing for A and T. In RNA you follow the same rule. If we have lets say 27% of our DNA as A we have to have 27% as T leaving 23% as C and 23% as G. If there was lets say 29% T while one 27% A then there was a error in DNA replication and could lead to errors in RNA synthesis if not corrected

4 0
3 years ago
Other questions:
  • Which of the following statements is FALSE regarding TFIID?
    7·1 answer
  • To perform a testcross, scientists cross an organism with an unknown genotype with a _____ organism.
    12·2 answers
  • What is the definition of chloroplast
    14·2 answers
  • Read each example and identify it with one of the mechanisms that influence gene pools. A zebra migrates to join a different her
    11·2 answers
  • The recirculation of fluids in the body is essential to homeostasis, eliminating local variations in the fluids, maintaining blo
    13·1 answer
  • What is a cell with two pairs of each set of chromosomes
    6·1 answer
  • The Statue of Liberty is made of copper that has turned green because it has undergone a change. What can be said about this cha
    9·2 answers
  • Biologists use the system of binomial nomenclature developed by Linnaeus to assign scientific names to known living organisms. W
    10·2 answers
  • Help me please it’s biology
    5·2 answers
  • Des a magnetic field flows though the inside of a magnet
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!