1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Colt1911 [192]
3 years ago
12

Some potassium-sparing diuretics increase urination without the loss of potassium by working against receptors for: Some potassi

um-sparing diuretics increase urination without the loss of potassium by working against receptors for: adrenocorticotropic hormone (ACTH). cortisol. glucocorticoids. aldosterone.
Biology
1 answer:
12345 [234]3 years ago
7 0

Answer:

The correct answer is Aldosterone

Explanation:

Aldosterone is a steroid hormone that is secreted from the adrenal cortex.Aldosterone helps in the excretion of potassium ions from our body.

       That means if potassium sparing diuretics increase urination witout loss of potassium ion from our body then these diuretics will have to work against receptor foe aldosterone.

You might be interested in
A catabolic pathway may be which of the following? a. a set of reactions that combine monomers into larger, more energy-rich pol
KiRa [710]

Answer:

The correct answer is option c. "a set of reactions that release energy that can be used to drive cellular work".

Explanation:

Catabolism is a part of metabolism at which molecules are broken down into smaller units in order to release energy that could be used in other reactions that drive cellular work. A catabolic pathway follows catabolism criteria. Catabolic pathways are the opposite of anabolic pathways, at which large molecules are synthesized with the requirement of external energy supply.

5 0
3 years ago
Which of these statements best describes evolution? a. the progression through time from simple to complex organisms. b. a proce
guapka [62]
The answer is <span> b. a process of change through time.

Evolution is a process of change through time.  It does not result in progress. Natural selection, one of the mechanisms of evolution, can result in progress and </span>cause some organisms to develop characteristics they need. But generally speaking, natural selection is not the only mechanism of evolution. Other evolutionary mechanisms, such as genetic drift, mutations, migration, can in some cases have a harmful outcome.  
5 0
3 years ago
Explain why all mutations are not necessarily harmful.
riadik2000 [5.3K]
Some mutations in living species help them to adapt and help protect them from predtors
5 0
3 years ago
Read 2 more answers
Microtubule structures that help separate the chromosomes during mitosis
Goryan [66]

Answer:

O fuso mitótico

Explanation:

fuso é uma estrutura feita de microtúbulos, fibras fortes que são parte do "esqueleto" da célula. Sua função é organizar os cromossomos e movê-los durante a mitose. O fuso cresce entre os centrossomos a medida que eles se separam.

7 0
3 years ago
Will give Brainlyist
Sedbober [7]

Answer:

G

Explanation:

3 0
3 years ago
Other questions:
  • Compare and contrast inbreeding and hybridization
    14·1 answer
  • When species interact, as fungi and algae do in lichen, so that the interaction of the two species increases the fitness of both
    15·1 answer
  • Are genetic defects associated with abnormalities of autosomes or of sex chromosomes
    5·1 answer
  • If a gene has one completely dominant allele and one recessive allele, how
    5·1 answer
  • Deer are mammals, and therefore have systems that are basically the same as other mammals.
    14·2 answers
  • in a cross of heterozygous RW four o'clock plants (RW*RW) what proportion of the seeds will grow to produce pink flowers
    8·1 answer
  • Simon and his friends are working on an experiment to determine the most common blood type group in California. Which of these m
    5·1 answer
  • PLEASE ANSWER ASAP!!!
    11·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • How many sugar molecules make up simple carbohydrates?
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!