1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
madreJ [45]
3 years ago
12

If all the droplets were the same size, which would fall most slowly through the apparatus?

Biology
1 answer:
Alenkinab [10]3 years ago
5 0
If all the droplets were the same size, the droplet with the smallest charge <span>would fall most slowly through the apparatus. Basically, buoyancy is the same for all droplets but the electrical force would be different for each. The higher the electrical force the greater is the gravitational pull towards that droplet. Therefore, the droplet that has the </span>smallest charge<span> would drop most slowly.</span>
You might be interested in
Help? &lt;3
telo118 [61]
They lack rhyme scheme and rhythm, but they are still an artistic expression. hope this gelped! :))
8 0
3 years ago
*WILL MARK BRAINLIEST* Can someone PLEASE help me with this??
mixer [17]

One is cells I think

3 0
3 years ago
What prevents a lake or ocean from freezing solid
inessss [21]
The surface layer of the water freezes solid creating a barrier that insulates the ice below so that it keeps a steady temperature usually a few degrees above freezing (32 degrees).

7 0
3 years ago
Determine which of the three
prohojiy [21]

Answer: North America

Explanation: About 80 million years ago, North America and Europe, Australia and Antarctica, and India and Madagascar followed suit and separated. Over millions more years, the continents moved to their approximate current positions.

7 0
3 years ago
Which is a homologous chromosome pair?
nadezda [96]

Answer: Homologous chromosomes are the pairs of chromosomes that having same gene sequence, equal length of arms and centromere location. Homologous chromosomes have two homolog one come from male parent and other come from female parent.

Explanation:

These chromosomes Are formed for the purpose of genetic variations. They are called homologous because when two same structured exist it form pair together

8 0
3 years ago
Other questions:
  • Which land formation is not the result of a convergent boundary A. Hawaii islands B. Himalaya mountains C. Marianas islands D. A
    15·1 answer
  • The structure of molecules that make up proteins
    15·1 answer
  • Foodborne illness can come from a variety of sources. most commonly implicated are bacteria, viruses, parasites, and toxins. the
    7·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Question 5 of 9
    7·2 answers
  • What does the plasma membrane of a phagocyte attach to on a microorganism?
    14·1 answer
  • All tropisms are physical changes true or false
    8·1 answer
  • Genes determine the of organisms. why do you guys give a whole essay for a dang answers but thx anyways
    9·1 answer
  • The image below shows an example of a macromolecule.
    5·1 answer
  • Explain why the structure of mitochondria and ribosomes was not well understood before the development of the electron microscop
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!