1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
anastassius [24]
3 years ago
5

Foresters recently noticed an apparent drop in the squirrel population in a near-by oak-hickory forest. The squirrels eat acorns

produced on the oak trees; hawks eat squirrels. The foresters are not sure what is causing the decline in the squirrel population but they are concerned that both the squirrel and hawk populations will disappear.
How could they best find an answer to their question?

A) Tag and track the hawks in the area.

B) Conduct a decade long population study.

C) Monitor the acorn production of the oak trees for several seasons.

D) Use a computer simulation model of the potential forest populations.
Biology
1 answer:
joja [24]3 years ago
4 0

D.Use a computer simulation model of the potential forest populations.

You might be interested in
If a tall plant (TT) is crossed with a short (tt) plant, all of the offspring will be: *
kicyunya [14]
I am pretty sure the answer is D (combination)
7 0
3 years ago
Read 2 more answers
Action potentials in the heart spread from cell to cell through
Leni [432]

Answer:

Gap junctions within the intercalated disks

Explanation: Gap junctions within the intercalated disks allow impulses to be propagated from one cardiac muscle cell to another. It allows sodium, potassium, and calcium ions to flow between adjacent cells, propagating the action potential, and ensuring coordinated contractions.

8 0
3 years ago
What are the chances of the offspring for having a round shape?
Evgen [1.6K]
You need to know if the parents trait are dominant or recessive
7 0
3 years ago
What parts of the nucleotides make up the rungs if the “ladder”
zlopas [31]
I’m pretty sure the answer is sugar and phosphate.
5 0
3 years ago
What do all cells need in order to perform cellular respiration?
olga2289 [7]

Answer:

Oxygen I believe

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • One way of balancing the concentration of ions and molecules within a cell is to use all but ______________ . ATP transfers one
    13·2 answers
  • ¿Cuántos genotipos recesivos hay?
    8·1 answer
  • Which statement about cellular respiration is true?
    15·1 answer
  • A normal Q wave is a result of what
    8·1 answer
  • 8) Outline what you would need to know to answer the following question: of all the proteins that exist on earth at this time, w
    11·1 answer
  • What do you think is happening to the temperature as the aquanauts go deeper and deeper into the ocean? Hint: There is less sunl
    14·2 answers
  • Select the correct answer from each drop-down menu.
    9·1 answer
  • How could a change in the DNA sequence of a single gene affect an organism?
    8·1 answer
  • (b) Explain why an individual was found to have a high urea content in his urine after
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!