1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zzz [600]
4 years ago
9

Exchange of nutrients, gases, and waste molecules occurs across capillary walls. fluid is also exchanged. most of the fluid is m

oved by ____________ which, in turn, is due to the pressure differences between the capillary fluid and interstitial fluid.
Biology
1 answer:
bagirrra123 [75]4 years ago
6 0

The correct answer is filtration.

The small molecules can cross in and out of the capillaries through facilitated or simple diffusion. However, the majority of the flow of capillary and tissue fluid takes place through the process of filtration and reabsorption. Filtration refers to the movement of the fluid out of the capillaries and is mediated by the capillary hydrostatic pressure.

You might be interested in
Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
Tomtit [17]

Answer:

I'll break this into threes so its easier to read;

TTC ATG CTA GCT ACG TGT ACG TAC CGA TGC G

Explanation:

In DNA, the A bases goes with the T bases, and the C bases go with the G bases.

3 0
4 years ago
Which of the following is not a symptom of influenza?
aleksandr82 [10.1K]

Answer:Diarrhea

Explanation:

Influenza is a type of viral infection. It is commonly described as flu. Its symptoms are usually worse than normal cold.

Most of the symptoms of  flu are not observed during the starting few days and one may transfer it to another person before knowing about it.

The main symptoms of flu includes headache, dry cough, muscular aches. It does not includes diarrhea.

6 0
3 years ago
What happens to the stomata in the daylight hours
vladimir2022 [97]

Answer:

they open up to get the energy from the sun.

Explanation:

8 0
4 years ago
Radiation from structures that have a very high temperature is collected by
tresset_1 [31]
Radiation damage is the major impediment for obtaining structural information from
6 0
3 years ago
Which RNA nucleotide can pair with the Thymine (T) at the beginning of the strand? Drag it into the DNA antisense strand to make
Alex Ar [27]
Thymine (T) can pair with Adenine (A)
6 0
3 years ago
Read 2 more answers
Other questions:
  • Que células se dividen por mitosis y cuales por meiosis
    10·1 answer
  • The crossed extension reflex is the contraction of the extensors on one side of the body when the flexors are contracted on the
    12·1 answer
  • _______ are organisms that recycle nutrients from decaying organic material.
    7·1 answer
  • Which flowchart correctly shows how genes are inherited?. . A. DNA→ RNA→ protein→ trait. . B. trait→DNA→ protein→ RNA. . C. RNA→
    15·1 answer
  • Dose the amoeba cell have cells?
    12·2 answers
  • What are the stages of mitosis in order
    6·1 answer
  • How do animal cells, Plant cells, freshwater protists, and
    10·1 answer
  • Male Lions have a large tuft of longer fur that surrounds their neck. We
    9·1 answer
  • During which phase of the cell cycle do sister chromatids first appear?
    6·1 answer
  • Please help idk what’s the answer
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!