1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Westkost [7]
3 years ago
5

Image below please its due in like 30 minutes and this is only the second question

Biology
1 answer:
Elodia [21]3 years ago
7 0

Answer:

the second choice is incorrect

Explanation:

plz give me brainliest i only need one more to increase my level!

You might be interested in
Earth's dynamic processes allow our planet to recycle:
adoni [48]
The answer for this question would be choice <span>B) Water, rock, and surface materials, or the second option.</span>
6 0
3 years ago
Read 2 more answers
If there were no decomposers, which of the following would most likely happen?
Luda [366]

Answer:  i would think that the earth would naturally ware it down over time if there are no decomposers

Explanation:

6 0
4 years ago
Why are protists like animals?
AfilCa [17]

Answer:

A protozoa is animal-like

Explanation:

They share some traits of animals, they eat things outside of themselves.

4 0
3 years ago
Which of the following is not a symptom of influenza?
aleksandr82 [10.1K]

Answer:Diarrhea

Explanation:

Influenza is a type of viral infection. It is commonly described as flu. Its symptoms are usually worse than normal cold.

Most of the symptoms of  flu are not observed during the starting few days and one may transfer it to another person before knowing about it.

The main symptoms of flu includes headache, dry cough, muscular aches. It does not includes diarrhea.

6 0
3 years ago
The most plentiful gas in the atmosphere is …
frosja888 [35]

Answer:

By far, the most abundant gas in the Earth's atmosphere is nitrogen, which accounts for about 78% of the mass of dry air.

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • Which organism has a nerve net that allows it to respond to a stimulus in a coordinated way?
    14·1 answer
  • Scientists believe the first giraffes on Earth had shorter legs and a shorter neck than giraffes today. What can you conclude ab
    13·2 answers
  • These offspring showed variations in body shape and coloration.
    6·1 answer
  • It is impossible to overhydrate because people need as much water as they can drink to carry out ordinary body functions.
    8·1 answer
  • Phosphorus is very important for living things because living organisms need phosphorus for what?
    11·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Name the six types of cellular respiration and what they do
    7·1 answer
  • Researching the question "Should we dissect?"Include:
    6·1 answer
  • All you need is in the photo ​
    6·1 answer
  • What are the advantages and disadvantages of the method used in the video? You may conduct additional research on the Internet i
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!