What do you mean what is the topic on the group discussion
Answer:
Ecosystem services are the goods and services that biodiversity provides. They include soil formation, the provision of food and fibre, air quality and climate regulation, the regulation of water supply and quality and the cultural and aesthetic value of certain plants and species.
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Answer:
A mutation is the changing of the structure of a gene, resulting in a variant form that may be transmitted to subsequent generations, caused by the alteration of single base units in DNA, or the deletion, insertion, or rearrangement of larger sections of genes or chromosomes. Mutations in sex cells are more serious because they are heritable and affect the next generation.
Explanation:
Answer:
These crops where improved with technology, production of high-yielding variety, and improve farm practices. All these ensured the crops of green revolution had increase yield.
Explanation:
Through genetic engineering, high-yielding variety of cereals e.g wheat, maize, rice, were genetically engineered so that certain features which enhanced increased productivity were selected for.
Use of fertilization, the adoption of mechanization,good cropping and farming system are other factors which enhanced yield of these crops. Specifically, these crops were modified to enhance their Nitrogen uptake, which promotes rapid growths.
