I believe it's B. That would be the best guess
The answer is; true
These microbes are usually adapted to their environment and this is why they are found in virtually all ecosystems. You will find bacteria even at the bottom of deep ocean beds deep and in geothermal vents, hypersaline water and very cold regions (such as polar regions). Fungi which vary widely in size from microscopically small to the largest organisms such as mushrooms are also found in virtually all environments on earth. They are nonetheless different species of these groups adapted to their environments.
Answer:
Cross a red flower (AaBB) with a pink flower (AaBb). What are the expected phenotypic ratios of offspring?
AaBB x AaBb= AABB, AaBb, AaBB, aaBb
Phenotyic ratio is 3:1
Explanation:
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer:
c
Explanation:
Electrical power is the correct answer
