1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mumz [18]
3 years ago
13

How are wind and solar energy better than oil and coal energy?

Biology
1 answer:
umka2103 [35]3 years ago
8 0

Answer:

they are a renuable resource where as coal and oil take many many years to have again

Explanation:

You might be interested in
Cross sections of different areas of the same plant show cells with very
AnnyKZ [126]

Answer:

C. The cells in these two areas have different functions.

Explanation:

The plant tissues are classified into three major systems: vascular, epidermic, and root systems. The vascular system is formed by tissues referred to as xylem and phloem. The epidermis is composed of superficial tissues that cover plant organs (i.e., leaves, stem, roots, etc). Finally, the root system is formed by tissues whose function is to supply to other plant tissues and store nutrients. Moreover, the plant tissues are also classified into meristematic and permanent tissues. In this case, it is reasonable to suppose that structurally different plant cells that are located at different areas of the plant will have distinct functions.

6 0
3 years ago
Cystic fibrosis is a genetic disease in humans in which the CFTR protein, which functions as a chloride ion channel, is missing
KiRa [710]

Answer:

ABC transporter protein

Explanation:

ABC transporter protein refers to the ATP binding cassette protein which utilizes the AT energy to transport the substrates from one side to another side. The ABC proteins are one of the oldest proteins known in the organisms.

The CFTR protein which acts as a chloride channel in the membrane which transports the chloride ions across the membrane utilizes the ATP energy in the transport.

Thus, ABC transporter protein is correct

4 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Which part of photosynthesis is represented by the diagram to the right
Yanka [14]

Answer:

<em>Light-dependent reactions</em>

<em></em>

Explanation:

Photosynthesis occurs in two stages: light-dependent reactions and light independent-reactions. This last stage is often called Calvin cycle.

The diagram shows reactions occurred in the thylakoid membranes which are located inside the chloroplasts. Therefore, we can identify that these reactions are the light-dependent reactions. During this part of photosynthesis, the energy from the sunlight is absorbed by a pigment called chlorophyl (Chl). Then, it is sequentially coverted into chemical energy stored in the form of molecules: NADPH (nitotinamide adenine dinucleotide phosphate) and ATP (adenosine triphosphate).

8 0
2 years ago
Which three statements correctly describe the endoplasmic reticulum?
Sunny_sXe [5.5K]

I have searched everywhere, but I have not found the proposals of the question, but I will explain to you what is the endoplasmic reticulum so that you can answer it.

The endoplasmic reticulum is a eukaryotic organelle located in the cytoplasm.

The endoplasmic reticulum is a network of membrane tubules (often interconnected) scattered throughout the cytoplasm of eukaryotic cells. Its membrane, which alone represents more than half of the cellular membrane system, is in contact with the nuclear envelope.

The endoplasmic reticulum can be:

Granular (or rough) (RER) that is to say associated with ribosomes.

Smooth (SER).

The granular endoplasmic reticulum is the place of synthesis (in the associated ribosomes) of the proteins secreted outside the cell and of the proteins and lipids constituting the membranes of the cellular organelles. Golgi, lysosomes, mitochondria, nucleus, ribosomes, vesicles ...). It participates in the correct folding of the proteins that have just been synthesized.

The smooth endoplasmic reticulum participates in cellular metabolism, synthesizing lipids and storing calcium.

5 0
3 years ago
Other questions:
  • Can someone help? For 60 points pls help
    15·2 answers
  • Similarities between rotating earth and non rotating earth
    5·1 answer
  • What are the causes and effects of climate change?
    8·1 answer
  • if shoe it to foot , as glove is to hand...complete the following: Simple sugar (monosaccharide) is to carbohydrate as amino aci
    7·1 answer
  • How are excited electrons from stage one of photosynthesis affect stage 2
    13·1 answer
  • Which of these CORRECTLY explains the difference between the processes of photosynthesis and respiration?
    12·1 answer
  • "Which of the following statements are true?
    15·2 answers
  • Chickens can have different types of feathers. Frizzled feathers curl toward a chicken’s head. Assume that feather type is deter
    13·2 answers
  • Bees and butterflies are dependent on flowers for their food. However, the more successful of the two will get the nectar. Which
    10·2 answers
  • at what distance from the earth's surface is the gravitational potential energy of a spaceship-earth system reduced to half the
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!