Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
1.
Explanation:
Atomic mass is protons+neutrons. Atomic number is just protons.
Answer:
A scientific model is a representation model for a certain scientific concept. Scientific models make it easier to study a phenomenon as they tend to model out the exact phenomenons.
A drawing of an skeleton would be unclear as the children might not be able to locate certain features in the drawing. For example, a certain joint could be missed by the teacher in the drawing or the child might not exactly be able to locate where the joint or bone is present.
But as the model will be more real to the actual skeleton system hence, studying through a skeleton will make it a lot easier to study the human skeletal system.
The awnser would be D the tilt on the earth on its axis
Answer - True
Reasoning - The reason is without predation the animals will die since if they won't hunt they won't eat and die. Yes it's important to because it helps maintain the ecosystem. For example a Tiger is on top of the food chain so it's to gotta hunt. Just like down those line of chains.
