1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
STALIN [3.7K]
4 years ago
8

2. What parts of the environment, natural and manmade, make up a watershed?

Biology
1 answer:
grin007 [14]4 years ago
4 0

<u>Answer:</u>

Natural: mountains, rocks, soils, ecosystems, etc.

Manmade: artificial streams or tributaries, roads, farms, etc.

<u>Explanation:</u>

A watershed a geographical area that drains all forms of surface water (rainfall or snowmelt) from <u>higher altitudes</u> (e.g. top of mountains) to the <u>lower altitude</u> (e.g. rivers) thus draining the water to the same place.

Since watershed is a large area, it often comprises both natural and manmade features. Manmade features are typically the roads or (small) cities that are developed by humans in the hilly areas. On the other hand, natural features are developed due to the natural action of hydrogeological and/or meteorological conditions over the course of longer time periods.

You might be interested in
Which bee has the most important job? Support with 2 reasons
Dennis_Churaev [7]
Globally there are more honey bees than other types of bee and pollinating insects, so it is the world's most important pollinator of food crops.
3 0
3 years ago
Use the word "passive transport" in a sentence.
alekssr [168]
 " What does passive transport mean " Good  sentence or no
7 0
4 years ago
The initiator tRNA occupies which site on the ribosome?
Katen [24]
A is the best answer i just took the test.
3 0
3 years ago
Read 2 more answers
What are the products of anaerobic respiration in: <br><br> -plants <br> -Animals
Ulleksa [173]

Answer:

In anaerobic respiration, the end-products are ethanol and carbon dioxide in plants whereas the end-products are lactic acid only in animals.

Explanation:

3 0
2 years ago
Read 2 more answers
What structure covers organs of mollusks?
Fed [463]
I believe that would be the mantle. Hope this helped!
7 0
4 years ago
Other questions:
  • Which of the following statements is a prediction? A. Aggressive chimpanzees should be monitored during meal times or fed separa
    5·2 answers
  • what is the best way to describe the evolutionary changes that happen in the lizard population over time?
    14·1 answer
  • Which type of experiment did he conduct to answer his question
    13·1 answer
  • A major oil spill has just happened in a near-shore environment. What prediction could be made as to why an oil spill in this ar
    6·2 answers
  • What is the name given to the phenomenon in which some individuals with a particular genotype fail to display the corresponding
    6·1 answer
  • During Cellular Respiration what is used to create energy?
    8·1 answer
  • Is soil living or nonliving explain why or why not?
    7·1 answer
  • What is the complementary DNA of TACCGGATGCCAGATCAAATC?
    10·1 answer
  • An example of a pressure vessel is
    10·1 answer
  • HELPPPPPPPPPPPPPPPPPP
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!