1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ahat [919]
3 years ago
8

What are 2 nutrients that cause eutrophication

Biology
1 answer:
agasfer [191]3 years ago
4 0
Nitrogen and phosphorus?
You might be interested in
Number of sets of chromosomes in mitosis
raketka [301]
This depends on what organism you're referring to.
Humans have 23 sets of chromosomes. 
In mitosis, identical cells are being produced. 
8 0
3 years ago
Read 2 more answers
The Yellowstone National Park Food Web Is Shown Below
AlexFokin [52]

Answer:

C. Increased Aquatic Plant Population

Explanation:

If the wolves eat the beavers than there is less beavers. If there is less beavers than there are more aquatic plants.

4 0
3 years ago
Davy made a model of the water cycle by adding some water inside a plastic bag, sealing the bag, and placing it in a sunny area.
Ad libitum [116K]

<em>Davy made a model of the water cycle by adding some water inside a plastic bag, sealing the bag, and placing it in a sunny area. He noticed that the level of the water went down, and then some droplets appeared on the sides of the bag. which part of the water cycle caused water droplets to form on the side of the plastic bag?  </em>

<em>(a) condensation (b) evaporation (c) precipitation runoff</em>

The part of the water cycle that caused water droplets to form on the side of the plastic bag would be condensation.

<h3>What is condensation?</h3>

It is a process whereby water vapor in the atmosphere condenses or turns back into liquid.

Condensation is as opposed to evaporation. The latter is a process whereby liquid water turns into vapor water. In other words, evaporation and condensation are words and opposites.

Both processes play a major role in the water cycle of the ecosystem.

More on condensation can be found here: brainly.com/question/15563071

#SPJ2

4 0
2 years ago
Describe the drug that Dr. Jacobson used on JFK.
Zina [86]

Answer:

It cannot be said with certainty that the Kennedys or, with a few exceptions, any other specific patient received amphetamine. It is known, however, that Dr, Jacobson uses unusually large amounts of amphetamine in his practice. The doctor's office reported that

6 0
3 years ago
Pollen can be used as an indicator of past climates and vegetation. give two reasons why pollen is well suited to this use:
almond37 [142]

Answer:

A.) Pollen are well preserved in the sediment layers because they are highly resistant to decay.

B.) Other indicators that can be used to determine past climates are through the analysis of the width of tree rings and the coral reefs formed underwater.

7 0
3 years ago
Other questions:
  • Motor information which tends to slow heart rate, stimulate parts of the digestive system is carried from the brain in the _____
    8·2 answers
  • In the moss life cycle the diploid embryo grows into a sporophyte. This sporophytc grows out of the A. spore. B. antheridium. C.
    15·1 answer
  • In which phase of meiosis would certain gene segments of the homologous pairs of chromosomes "cross over" and exchange genetic i
    6·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • The diagram shows how an enzyme binds to a substrate during a chemical reaction. When this reaction is complete, the
    14·1 answer
  • A team of researchers calculates that a glacier will melt completely away in the next 100 years. Which land structure will most
    7·1 answer
  • Find 4 human-related threats to seagrasses. Describe them fully.
    7·1 answer
  • It is a statement of judgment of a person about something in the world.<br>​
    9·1 answer
  • Please help. Please be 100% sure of your answer. Thank you. ​
    10·2 answers
  • What letter represents a trench?<br> a. A<br> b. B<br> c. C<br> d. D<br> e. E
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!