1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Cerrena [4.2K]
3 years ago
15

Which of the following systems help in absorbing Oxygen and releases carbon dioxide

Biology
1 answer:
Marina CMI [18]3 years ago
6 0
Photosynthesis is the correct answer, where plants release oxygen and humans use this to release carbon dioxide into plantes
You might be interested in
Which devices trap suspended particles in air by spraying water and other liquids? wet scrubbers
irina1246 [14]
The answer is - wet scrubbers
4 0
3 years ago
Read 2 more answers
Which of these conditions made it beneficial for aquatic plants to move onto land?
Elena L [17]
Adaptation would make the most sense
7 0
3 years ago
Read 2 more answers
If a TRNA had a AGC anticodon it could attach a
Contact [7]

A transference RNA (tRNA) is an adapter molecule that decodes a codon messenger RNA (mRNA) during the synthesis of a polypeptide chain. These molecules (tRNAs) play a fundamental role during translation.

  • If a tRNA had an AGC anticodon it could attach a codon having the sequence UCG.

  • During translation, tRNAs act at specific sites in a ribosome to synthesize a polypeptide chain (i.e., a protein) from an mRNA sequence.

  • The anticodon of the tRNA binds by base complementary to a triplet of nucleotides or 'codon' in the messenger RNA (mRNA) during protein synthesis (i.e., translation).

  • According to the base complementarity rules, in RNA, Adenine always pairs with Uracile (Thymine in DNA), whereas Guanine always pairs with Cytosine.

Learn more in:

brainly.com/question/10014731?referrer=searchResults

5 0
2 years ago
1 point
amm1812

Answer:

The pairing of the nitrogen bases in a DNA molecule is AT and CG. Let's say that the DNA strand has the sequence of ATCG. The complementary strand of that DNA strand will be TAGC. A and T & C and G must pair with each other. The replicated strand will be the same as the original strand because the complementary strand of the replicated strand will be ATCG, which is the same as the original strand.

Explanation:

4 0
3 years ago
JUST ONE PLZ!
statuscvo [17]

Answer:

Igneous

Explanation:

6 0
3 years ago
Other questions:
  • Is the measure of how bright a star would be if it were located at a standard distance from Earth.
    15·1 answer
  • The purity of cocaine in crack averages about __________.
    13·1 answer
  • When an airplane increases its thrust, which of the following could happen
    8·1 answer
  • The stretch hold is a restraint technique:
    15·1 answer
  • PLEASE HELP I feel like the answer is number 4 but im not sure.
    15·1 answer
  • Terri has been extremely sad, despondent, and guilt-ridden for over a year. in addition to this deep depression, she has also ha
    7·1 answer
  • Please help me ~15points~<br> EXPLAIN WHAT HEAT INDEX IS?
    9·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • Which of these zones of the ocean is deepest?
    12·1 answer
  • Need help with this
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!