1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alisiya [41]
3 years ago
7

Assume that for a given gene a mutation creates an allele that functions as a dominant negative. The gene codes for a protein th

at forms a tetramer (4) within the cell. If at least one of the subunits has the mutant structure the entire protein is inactivated. For a heterozygous individual, what percent of the tretramers present in the cell will be inactive?
Biology
1 answer:
OlgaM077 [116]3 years ago
3 0

Answer: 100%

Explanation:

if the mutation presents autosomal dominant inheritance, each affected individual will show 100% alteration in the protein, thus , being dominant, it is considered that the disease pattern will predominate even if it has genes that do not express it since these will be recessive and canceled by the dominant ones.

You might be interested in
What is the cell shown an example of ?
Ainat [17]

It should be G eukaryotic tell me if im wrong


6 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
A functional or physiological adaptation:
nika2105 [10]

Answer:

A trust me.

Explanation:

are you functional adaption is an adaption that helps an organism survive in a certain environment, typically altered by a physical stimuli, dietary changes, or injury.

3 0
2 years ago
Read 2 more answers
Describe the properties of the sun
Lemur [1.5K]
Describe<span> the physical </span>properties of the Sun<span> (sunspot cycles, solar flares, prominences, layers of the </span>Sun<span>, coronal mass ejections, and nuclear reactions) and the impact of the </span>Sun<span> as the main source of external energy for the Earth</span>
6 0
3 years ago
A damages axon in the PNS may be able to regenerate only if the cell body is intact. Why do you think that the cell body must be
Sonbull [250]

Answer:

Explanation:

The central nervous system (CNS) does not have capacity to repair itself but, the PNS or the peripheral nervous system can repair and regenerate itself. The PNS can regenerate its damaged axon only when its cell body or cyton and its neurilemma are intact. The proximal end of the cyton has growth cones. The axon grows from the cones.    

6 0
3 years ago
Other questions:
  • Can someone give me an example of negative and positive feedback?
    11·1 answer
  • Choose the scientific question. A. Would you like to have a frog as a pet? B. Who is the smartest biologist alive today? C. Whic
    5·1 answer
  • The __________ nervous system mobilizes the body when one needs to exert tremendous energy (such as flee from an attacker).
    14·1 answer
  • What units measure the amountsof energy in food​
    9·2 answers
  • Select the correct answer.
    9·2 answers
  • Question6
    13·1 answer
  • What things make profession of different level​
    5·1 answer
  • In a human population of 1000 ,840 are tongue rollers and 160 are not tongue rollers .What is the frequency of the dominant alle
    11·1 answer
  • Our fellow student, Draco, wants to know how light intensity affects the
    6·1 answer
  • Destruction of lymphocytes with self-specificity is called select one:
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!