1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Solnce55 [7]
3 years ago
10

2. The instructions for the traits of an organism are determined by

Biology
2 answers:
densk [106]3 years ago
6 0

Answer:

the order of nucleotides in DNA molecules, hope this helped!

Explanation:

steposvetlana [31]3 years ago
3 0

Answer: The traits an organism displays are ultimately determined by the genes it inherited from its parents, in other words by its genotype. Animals have two copies of all their chromosomes, one from each parent.

Explanation:

You might be interested in
What enzyme breaks the hydrogen bonds between bases?
Naya [18.7K]
(A)Helicase is that enzyme...
5 0
3 years ago
What happens to codeine in the body
Assoli18 [71]
Search Results
Featured snippet from the web
Moreover, a small amount of codeine is converted to morphine in the body. The precise mechanism of action of codeine is not known; however, like morphine, codeine binds to receptors in the brain (opioid receptors) that are important for transmitting the sensation of pain throughout the body and brain.
7 0
3 years ago
Read 2 more answers
All of the following events occur during normal meiosis except _______. A. two haploid gametes fuse to form a diploid cell B. on
lesya692 [45]

Answer:

A. two haploid gametes fuse to form a diploid cell

Explanation:

Meiosis is a type of cell division. When a parent cell with "2n" chromosomes enters the process of meiosis, four daughter cells each with "n" chromosomes are formed. This occurs since homologous chromosomes separate from each other during anaphase-I. However, meiosis does not include the fusion of two haploid cells. The fusion of two haploid cells mainly occurs during the process of fertilization during which a haploid male gamete and a haploid female gamete fuse to form a diploid zygote.

7 0
3 years ago
When joints are not regularly moved through their entire range of motion, muscles and ligaments eventually _____. a. shorten b.
zhuklara [117]

Answer:

a. shorten

Explanation:

Inability or failure for joints to move through their entire range of motion is caused by constrictions. These constrictions often results when the excess adipose tissues that surrounds the muscles and ligaments are not in required adequate proportion. These constrictions can be caused by ageing, fatigue, muscular diseases etc. As a result of these constriction in the joints, let say for example, the knee joint, the muscle and ligaments tends to shorten in length.

7 0
3 years ago
Lipids are important to living things for all of the following reasons, EXCEPT that they are
Strike441 [17]
ANSWER:

Needed to form cell membranes

I hope I was of help to you :)
6 0
3 years ago
Other questions:
  • In which of the following situations is a plant reproducing sexually? A. A potato plant produces a tuber, and the next year, a n
    15·2 answers
  • Ribosomes in details​
    11·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Plants make food through photosynthesis, a chemical reaction.
    12·2 answers
  • Which era spans the least amount of time on the<br> geologic scale?
    10·1 answer
  • From where plants gets carbon dioxide?
    11·1 answer
  • Does longer wavelength give more or less energy? explain
    5·1 answer
  • Cell like this has just left the lungs. What colour will it be?
    13·1 answer
  • List the products or outcomes for the following biological processes
    6·1 answer
  • The answers are
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!