1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Solnce55 [7]
3 years ago
10

2. The instructions for the traits of an organism are determined by

Biology
2 answers:
densk [106]3 years ago
6 0

Answer:

the order of nucleotides in DNA molecules, hope this helped!

Explanation:

steposvetlana [31]3 years ago
3 0

Answer: The traits an organism displays are ultimately determined by the genes it inherited from its parents, in other words by its genotype. Animals have two copies of all their chromosomes, one from each parent.

Explanation:

You might be interested in
Owls and hawks both eat rodents.They are also found in the same habitats.Since no two populations can occupy exactly the same ni
Scorpion4ik [409]
<span>No. Because the hawk and owl hunt similar prey but occupy different ecological niches.</span>
5 0
3 years ago
Food contains 1.1 g carbohydrates 13 g protein and 11 g fat how many calories does the food provide
Juliette [100K]

Answer:

‼️‼️‼️155.4 calories‼️‼️‼️

Explanation:

1 gram of fat = 9 calories

1 gram of carbohydrates = 4 calories

1 gram of protein = 4 calories

11x9 = 99

1.1x4 = 4.4

13x4 = 52

This would get you go this question thus the answer to your question

99 + 4.4 + 52 = 155.4 calories

6 0
3 years ago
WHAT IS THE cell membrane gateway system is specifically called the
jek_recluse [69]
The cell membrane gateway system you are looking for is called <span>Sodium Potassium Pump.</span>
6 0
3 years ago
The cell bodies of sensory neurons that are in clusters of neurons outside the spinal cord are called ____.
Nonamiya [84]

Answer:

The cell bodies of sensory neurons that are in clusters of neurons outside the spinal cord are called  ____

The answer is "dorsal root ganglia"

Explanation:

Explanations of some terms

Sensory neurons:

Sensory neurons, also known as afferent neurons, have cell bodies that are located in the dorsal ganglia (also known as  spinal ganglia) of the spinal cord. Most sensory neurons have one axon which is split into two branches, they transmit impulses toward the spinal cord.

Spinal cord:

The spinal cord is a tubular structure composed of nervous tissue housed within the vertebral column, runs from the base of the brain to the lower spine. Spinal cord is a component of the Central Nervous System that serves as information highway the between brain and the body which Integrates and processes information. It can function with the brain and can also function independently of the brain.

Dorsal root ganglia:

Dorsal root ganglia also known as dorsal ganglia originated as bipolar cells. They exists within the peripheral nervous system and they have special nerve cell clusters that aid in transmitting the sensory messages of pain and touch. The dorsal root ganglia receive information from sensory receptor organs and transmitting the information to the central nervous system.

4 0
3 years ago
Give 2 ways that exposing non-pathogenic bacteria to antibiotics as a side effect of antibiotic treatment for a pathogen may inc
Airida [17]

Answer:

The resistance of the bacteria to antibiotics is increasing and the disease which were easily treatable using the antibiotics, are now incurable and bacteria becomes resistant.  

The overdose and misuse of antibiotics Is a big concern of worry. Every time we use antibiotics, it will kill the bacteria which were sensitive but resistant bacteria will survive and starts growing and this process will increase the growth of the resistant bacteria upon the nest use of the antibiotics.  

Also due to unawareness, the use of antibacterial tablets against viral infections also cause increase in resistance of bacteria against antibiotics.  

4 0
3 years ago
Other questions:
  • Manual methods are inferior to automated methods. <br> a. True <br> b. False
    9·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • What are some similarities and differences between physical and chemical weathering
    15·1 answer
  • Bioaccumulation is the buildup of a persistent pesticide in __________ . biomagnification is the buildup of a persistent pestici
    7·1 answer
  • A women brings her 5 year-old nephew to you for evaluation of a wart. You feel there are 2 therapeutic options; treat the wart w
    6·1 answer
  • Carly has wavy hair. Her father has straight hair, and her mother has curly hair. Which type of inheritance pattern is responsib
    11·2 answers
  • Why is Trans fat not a healthy choice ?
    13·1 answer
  • During DNA replication, a DNA strand that has the bases TACGGAATCG produces a
    15·2 answers
  • PLEASE HELP ASAP I'LL GIVE BRAINLIEST!!
    11·1 answer
  • If a gray fly is crossed with a heterozygous black fly, which combination below represents the parental cross?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!