1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
WINSTONCH [101]
3 years ago
7

Not the first one.Just 2nd question.

Biology
1 answer:
irinina [24]3 years ago
7 0
The pond will continue to get smaller and posibly will not exist at all. The area will be covered in shrubs because the dirt had softened because of the water. I think this might be the answer or something like it. Hope this helps!
You might be interested in
What are the cells in animals that are used to destroy bacteria and viruses after combining with lysosomes
AVprozaik [17]

T killer cell or Cytotoxic T cells  are the cells in animals that are used to destroy bacteria and viruses after combining with lysosomes.

<u>Explanation</u>:        

The T cells kills the bacteria and virus. The T cells can easily identify the pathogen when combined with the lysosomes. The activated T cells releases a material called perforin. This substance gets into the walls of the affected cell and punctures its walls. Due to hole in the walls, there happens discharge of fluid and electrolytes, which leads to the death of the cell.  The substance secreted is the cytolytic proteins from the lysosome which helps in destruction of the infected cells.  

3 0
4 years ago
Which of the following statements provides the best evidence that there is a common genetic code that demonstrates the unity of
wolverine [178]
What were the answer questions
8 0
2 years ago
HELP I NEED HELP ASAP
xxMikexx [17]

Answer:

Oxygen and Hydrogen

Explanation:

H2O

H = Hydrogen

O= Oxygen

7 0
3 years ago
Which of the following is FALSE regarding the DNA double helix?
jek_recluse [69]

Answer:

Which of the following is FALSE regarding the DNA double helix?

The two strands are parallel.

Explanation:

DNA strands are anti-parallel to one another which gives room for their complimentary factor to come in play.

6 0
3 years ago
After a hunt a wolf eats more than it needs at that time. the extra glucose combines to form which substance?​
Anni [7]

Answer:

glycogen

Explanation:

8 0
3 years ago
Read 2 more answers
Other questions:
  • Consider the model of the food chain. Imagine there is a herbicide poison spill and all the grass is killed. How will this influ
    15·1 answer
  • Gravity causes:
    12·1 answer
  • The color of a person’s eyes is determined by a single pair of genes. If they are both blue-eyed genes, then the person will hav
    15·1 answer
  • What property of water allows it to stick to the sides of a vertical glass tube?
    14·1 answer
  • HELPP PLEASE BRAINLIEST ANSWER IF CORRECT
    6·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • A human cell containing 22 autosomes and a Y chromosome is
    15·1 answer
  • What is the goal of the Human
    11·2 answers
  • If yam cores were placed in a salt (NaCl) solution at 22 °C for 24 hours and the molar concentration is
    7·1 answer
  • The typical growth period of a cell occurs during which stage of the cell cycle?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!