<span>The control would be a plant grown without any fertilizer. This is called a negative control and is important in identifying the influence of the treatments on the tests. In this case, it would mean that the plant without fertilizer (control) is not expected to grow as large as in the other treatment. </span>
It is twisted to create a greater surface area for digesting and to increase the nutrient absorption.
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
A gene is a segment of DNA which encodes for the production of proteins(building blocks of life) which provides structure to our bodies. These proteins carry out bodily functions and determine the physical characteristics of an organism.<span>
</span>
Therefore the answer should be genes.
Answer:
The correct answer is - hom-O heidelbergensis.
Explanation:
hom-O heidelbergensis was one of the early humans who appeared in about 200-130 kya in Asia and 600-130 kya 2in Africa and Europe.
These humans have long but lower cranium, cranial features resemble Hom Erectus but 1200-1300 cc cranial capacity with smaller pre/molars. The occipital torus of these humans was very small.
