The predator species keeps the prey species under control. Without predators, prey animals would over populate.
Hope this helped.
Endothermic reactions require energy
Exothermic reactions release energy
The reactants of photosynthesis would be Carbon dioxide and water.
you can put a needle through it and it won't break.
Answer:
1. Inhibiting IP3 channels, leading to decreased Ca2 in the sarcoplasm and reduced contraction.
2. Increasing the relative activity of MLCP, leading to a decrease in tension.
3. Activating K channels, increasing K leaking out of the cell which hyperpolarizes it and decreases the likelihood of Ca2 entry.
Explanation
In smooth muscle, cyclic AMP (cAMP) mediates relaxation because cAMP inhibits a specific kinase required for myosin light chain protein (MLCP) phosphorylation, thereby triggering contraction in the smooth muscles. It has been shown that cAMP inhibits 1,4,5-trisphosphate (IP3)-dependent calcium ions (Ca 2+) release by activation of the cGMP-dependent protein kinase (PKG). PKG proteins act to modulate Ca2+ oscillations by stimulating sarcoplasmic Ca2+-ATPase membrane proteins, increasing Ca2+ in the sarcoplasmic reticulum stores and Ca2+ efflux from the cells, and activate voltage-gated potassium (K) channels, thereby leading to membrane hyperpolarization and reducing Ca2+ entry through Ca2+ channels.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
