When a primary tumor spread it called methastastasis
Answer:
The correct option is B. Activation energy
Explanation:
The activation energy is usually used to designate the minimum energy necessary for a given chemical reaction to occur, that is, the basic requirement for the reaction to proceed.
For a reaction to occur between two molecules, they must collide in the correct orientation and have a minimum amount of energy. As the molecules approach, their electron clouds are rejected. This requires energy (activation energy) and comes from the heat of the system, that, is, from translational, vibrational energy, etc of each molecule. If the energy is sufficient, the repulsion is overcome and the molecules are close enough for a rearrangement of the bonds of the molecules.
The concept of Activation energy was introduced by Arrhenius in 1889. Arrhenius suggested that molecules must prossess a minimum amount of energy to react. That energy comes from the kinetic energy of the clliding molecules. Kinetic energy serves to cause reactions, but if the molecules move very slowly, the molecules will only bounce when they collide with other molecules and the reaction does not happen. In order for the molecules to react, they must have a total kinetic energy that is equal to or greater than a certain minimum value of energy called activation energy.
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
A detritivore, also known as a detrivore, are heterotrophs or decomposers that act as nature's recyclers and feed on dead organic material/remains
