1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
irakobra [83]
3 years ago
7

Nitrogen in the atmosphere must be “fixed” before it can be used by plants. Atmospheric nitrogen is “fixed” by

Biology
2 answers:
Sladkaya [172]3 years ago
7 0
Atmospheric Fixation. The enormous energy of lightning breaks nitrogen molecules and enables their atoms to combine with oxygen in the air forming nitrogen oxides. These dissolve in rain, forming nitrates, that are carried to the earth.
Burka [1]3 years ago
7 0

Answer:

D) bacteria and lightning.

Explanation:

According to USA Testprep (Where the question came from), "Nitrogen is fixed or chemically combined with other elements to form a usable chemical compound. Plants are then able to use nitrogen in this form; they are not able to use it in its atmospheric form." I hope this helps those that try to find the answer.

You might be interested in
Compare and contrast earths layers
jarptica [38.1K]

Answer:

Earth can be divided into three mainlayers: the core, the mantle and thecrust. Each of these layers can be further divided into two parts: the inner and outer core, the upper and lower mantle and the continental and oceanic crust. ... The inner core is solid, while the outer core is liquid.

5 0
3 years ago
The basement membrane consists of __________ secreted by __________.
katen-ka-za [31]
<span>Proteins secreted by epithelial cells. The basement membrane forms as a thin protein fibre membrane with mucopolysaccharides. It separates an epithelium from underlying tissue. Its main function is to anchor epithelium to dermis underneath. The membrane consists of different extracellular matrix structural proteins.</span>
4 0
3 years ago
1. why are pyruvates converted into acetyl-coa prior to entering the krebs cycle? what does this conversion do to the pyruvate m
Volgvan

The Krebs Cycle can best use acetyl coA to make ATP and pyruvate breaks down into acetyl CoA and CO2 this conversion do to the pyruvate molecules.

The required details for pyruvate molecules in given paragraph

Pyruvate is a flexible organic molecule that includes 3 carbon atoms and useful groups - a carboxylate and a ketone group. Pyruvate is concerned in some of key biochemical processes, together with gluconeogenesis, that's the synthesis of glucose, in addition to the synthesis of different key biochemicals. Two molecules of pyruvate are transformed into molecules of acetyl CoA begin text, C, o, A, quit text.

Two carbons are launched as carbon dioxide—out of the six firstly found in glucose. The number one characteristic of pyruvate is to function the transporter of carbon atoms into the mitochondrion for entire oxidation into carbon dioxide.

To know about pyruvate molecules click here

brainly.com/question/1447060

#SPJ4

7 0
1 year ago
The left ventricular wall of the heart is thicker than the right wall in order to ________. A. pump blood through a smaller valv
kolezko [41]

Answer:

The correct option is: C. pump blood with greater pressure

Explanation:

The human heart is a muscular organ, present between the middle compartment of the chest and the lungs. Heart is responsible for pumping blood through blood vessels of the circulatory system. It is divided in the following four chambers: the right atria, left atria, right ventricle and left ventricle.

The wall of the left ventricle is thicker as compared to the wall of the right ventricle. This is because <u>greater force is required to pump the blood to the entire body.</u>

3 0
3 years ago
What is applied microbiology​
s344n2d4d5 [400]

Definition. Applied microbiology is a scientific discipline that deals with the application of microorganisms and the knowledge about them. Applications include biotechnology, agriculture, medicine, food microbiology and bioremediation.

8 0
3 years ago
Read 2 more answers
Other questions:
  • When a body cell divides through the process of mitosis the chromosomes in the daughter cells
    15·1 answer
  • What stimulates cell division?
    13·2 answers
  • The movement of the mantle shifts the plates of the Earth’s lithosphere. T or F
    12·2 answers
  • This question is only for applicants to scholars for medicine or scholars for dental medicine: what aspects about medicine (or d
    10·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • What is the waste product given off during photosynthesis
    5·2 answers
  • Once food has been broken down to be used in the cell for energy, what must also happen?
    14·1 answer
  • B<br> WA<br> Youngest<br> Oldest
    12·2 answers
  • POSSIBLE POINTS: 6.67
    9·1 answer
  • Sugars are mainly providing living things with what
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!