1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marianna [84]
3 years ago
6

Color is ________.

Biology
2 answers:
irinina [24]3 years ago
8 0
B caused by chemicals
Nina [5.8K]3 years ago
3 0
B. Color is caused by chemicals in the mineral
You might be interested in
What is a way a cell is put together called?
Alexus [3.1K]
<span>In table or Excel, it's merging or combining. 
In biology, cells generally don't combine, they split (mother cells splits into two daughter cells)</span>
4 0
2 years ago
Please help i’ll give the brainliest if you give a correct answer tysm
Eduardwww [97]

Answer:

C. how close earth is to the sun

5 0
2 years ago
Read 2 more answers
How do I know the phenotype and genotype percentage on a punnet square?
Nesterboy [21]

Answer:

Phenotypes are physical attributes. Genotypes are the alleles.

The phenotypes are 75% green peas and 25% yellow peas. This is because the capital G is a dominant allele and green is the dominant attribute and as long as 1 G is present, then the pea will appear green.

The genotypes are 25% GG, 50% Gg, and 25% gg.

Please thank!

3 0
3 years ago
In 1665, What structures did Robert Hooke observe through a microscope?
Semenov [28]
In 1665, Robert Hooke observed D. Cell Walls through a microscope!
7 0
3 years ago
Read 2 more answers
The lower limb bones are attached to the axial skeleton by the
aalyn [17]
The lower limb bones are attached to the axial skeleton by a ring of bones called the pelvic girdle. The pelvic girdle consists of the right and left hip bones.
The bones of the head and trunk of the vertebrate form the axial skeleton.

3 0
3 years ago
Other questions:
  • Which of the following processes removes carbon dioxide from ocean waters?
    10·1 answer
  • Over the past 50 years, many researchers and farmers have been selectively breeding cattle to be more resistant to diseases. bas
    11·1 answer
  • If two objects are compared at a certain distance, according to Newton’s law of universal gravitation, what is true? Complete th
    11·1 answer
  • How are "bands" inherited?
    11·1 answer
  • An allele that is masked when a dominant allele is present.
    13·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • Summarize: 
    13·1 answer
  • Glycolysis is the first step in cellular respiration. Which option best summarizes the process?
    14·1 answer
  • ASAP PLS
    7·1 answer
  • Forms of saprophytic nutrition?​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!