1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
just olya [345]
3 years ago
7

How is farming contributing to the decline in biodiversity?

Biology
2 answers:
seraphim [82]3 years ago
6 0
The answer is B. By polluting near by streams with pesticides and herbicides
Leokris [45]3 years ago
4 0

Answer:

The correct answer is the b-by polluting near by streams with pesticides and herbicides option

Explanation:

Hello!

let's solve this!

Agriculture is helping to reduce biodiversity since with the use of herbicides and pesticides, living things can no longer feed. Also when placed near streams, they also contribute to pollute the waters.

The correct answer is the b-by polluting near by streams with pesticides and herbicides option

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Can someone tell me what are the organisms of archaea?
hram777 [196]
Just like the bacteria, the archaea have evolved a diverse array of metabolic pathways. As extremophiles, their metabolism shows many adaptations to the extreme environments of their habitat. There are facultative and obligate anaerobes and aerobic organisms in this kingdom.
5 0
3 years ago
What type of government did egypt and the indian valley civilization have? How was power passed through generations?
ArbitrLikvidat [17]

Answer: Mesopotamia, china, indus River Valley, the mesoamerican empires..... in this case, the two rivers are the tigris and Euphrates. Mesopotamia. The name Mesopotamia was given to the middle eastern civilizations that existed between the Euphrates and Tigris Rivers.   :)

5 0
3 years ago
4. Which of these best explains the organization of the biosphere?
nasty-shy [4]

Answer:

the answer is A.groups of biomesmake up a community, andand groups of populations make up a biome.

8 0
3 years ago
What is the use of minutiae<br> (this has to do with forensic science &amp; finger prints)
Harlamova29_29 [7]

The use of minutiae in forensic science is to identify the major points in a finger prints.

<h3>What is forensic science?</h3>

Forensic science is the field of science that deals with the extraction of information especially from scene of criminal cases while making use of their physical evidence, such as fingerprints and DNA.

Minutiae points are the major features of a fingerprint image and are used in the matching of fingerprints.

Therefore, the use of minutiae in forensic science is to identify the major points in a finger prints.

Learn more about finger prints here:

brainly.com/question/2114460

#SPJ1

8 0
1 year ago
Other questions:
  • What happens to a living organism that does not obtain all four main types of macromolecules
    5·1 answer
  • PLZ HELP ASAP!!!! I WILL GIVE BRAINLIEST!!!
    9·2 answers
  • Bacteria and bacteriophages are undergoing an evolutionary battle. In particular, phages that infect Salmonella enterica can use
    11·1 answer
  • Is a membrane required for facilitated diffusion
    10·2 answers
  • A cell with 80 chromosomes undergoes meiosis. How many chromosomes are found in the daughter cells? How many daughter cells are
    6·1 answer
  • When conducting a biology investigation, why is it important to note the safety rules and symbols?
    11·2 answers
  • (I couldn't find science)
    10·2 answers
  • Instead of having roots and leaves, molds grow as thread-like filaments called _____.
    8·2 answers
  • Which molecules does a cell need from food to make these membrane
    6·1 answer
  • A blue-eyed myopic woman from a marriage with a brown-eyed man with normal vision gave birth to a brown-
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!