1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
german
3 years ago
15

Gametes that are motile are often called _____.

Biology
2 answers:
laiz [17]3 years ago
6 0
Gametes that are motile are often called sperm.
Arlecino [84]3 years ago
4 0

Answer:

Sperm

Explanation:

Sperm are the male gametes produced in the testicles. The main parts of the sperm are the head, the neck and the flagella.

The structure responsible for sperm <u>motility</u> is the flagella. It develops from the centriole and has the function of giving impetus for the sperm to reach the female reproductive system.

You might be interested in
Explain how erosion is different to weathering.
nikklg [1K]
Erosion transports/spreads broken down minerals while weathering is the processes of rocks and earth minerals being broken down.
6 0
3 years ago
What device can be used to make measurements globally?
Tema [17]

its C

because a rain gauge is for rain, a buoy is to tract temperature change in water and the currents. a thermometer is for temps outside for for yourself. and a satellite can track anything around the world

6 0
3 years ago
Read 2 more answers
What does it mean when we say that dna replication is semiconservative
Pavlova-9 [17]
DNA replication is semiconservative in the sense that is uses one old strand to create a new strand.

Thus, it conserves a strand to create a new item in a sense.

Hope this helps!
5 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
2 years ago
Please help me.... it's important for me
Y_Kistochka [10]
This contributes because their lifestyle revolves around food, and if they live near different areas, they will have to search for different types of food.
3 0
3 years ago
Other questions:
  • An area with a large population of valuable ocean organisms is called a(n)
    14·2 answers
  • Jordan is doing a science fair project on the effects of music on the growth of tomatoes yes to tomato plants plan a.m. Plan B t
    9·1 answer
  • A falcultative anaerobic organism is able to perform aerobic respiration in the presence of oxygen and fermentation in the absen
    10·1 answer
  • What is an explanation of why producers are always found at the lowest trophic level?
    11·1 answer
  • The biotechnological processes used by two geneticists are described below.
    11·2 answers
  • Describe one way the student could change the intensity of light reaching<br> the pondweed.
    10·1 answer
  • A male and female Oompah have the same genotypes: blue face (ff) and big feet (Ll). Determine what they’re offspring may look li
    7·1 answer
  • WILL GIVE BRAINLY IF CORRECT HELPPPPPP
    11·2 answers
  • If two non-tasters married and had a child, what are the chances that the child would be a taster?
    6·1 answer
  • If a flare occurs on the Sun 4 astronomical units away how much time would pass before a robot at that distance see the light fl
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!