1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
timofeeve [1]
2 years ago
6

The large number of individual languages documented in africa has resulted primarily from

Biology
1 answer:
tigry1 [53]2 years ago
5 0
<span>Thousands of years of isolation between tribal groups</span>
You might be interested in
From what direction do most weather systems move as they begin to affect New York State? (1) northeast (3) southeast (2) northwe
vova2212 [387]

(2) northwest or (4) southwest

4 0
3 years ago
Read 2 more answers
How many TOTAL valence electrons are in the molecule H 2 O ? 8,2,6,1
natta225 [31]

Answer:

8

Explanation:

Hydrogen has 1 Valence electron, and H2O has 2 Hydrogen. Oxygen has 6 Valence electrons so do 2+6 = 8. 8 Valence electrons! (Or one full shell not consisting of the first shell.)

3 0
2 years ago
Need help with the top question :p
murzikaleks [220]
Which of the following is the best explanation
for the presence of both chloroplasts and
mitochondria in plant cells? - If plants cannot
produce enough ATP in the process of
photosynthesis to meet their energy needs,
they can produce it in aerobic respiration.
Sugars are produced in chloroplasts.
6 0
2 years ago
Research this week will be done over the Nervous System
erik [133]

Answer:

The major organs of the nervous system are the brain, spinal cord, sensory organs, and all of the nerves that connect these organs together.

The nervous system reacts to the presence of danger(instinct), stores memories, control the 5 senses, and commands the rest of the organ systems to maintain homeostasis.

The nervous system works together with the respiratory system, the circulatory system, the muscular system, and many more.

8 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Other questions:
  • Arrange the steps in order to explain how a tornado form
    9·2 answers
  • _________________________are organisms that obtain energy and nutrients by absorbing or ingesting other organisms.
    12·2 answers
  • The fact that little albert learned fear toward not only a white rat but also a ball of wool and a rabbit represents:
    8·1 answer
  • Which properties of water plays an important role in the movement of water from the roots to the leaves in plants? universal sol
    15·2 answers
  • ________________ is the term that describes the displacement of an organ or tissue that protrudes through the wall or from the c
    11·2 answers
  • All life depends on the availability of usable energy. This energy is released when
    12·1 answer
  • Hail stones do a lot of damage when they fall to the earth and hit homes and cars with great force they hit with great force why
    13·1 answer
  • If you cry a lot, would you eventually go blind?
    11·2 answers
  • Proteins on the surface of vesicles determine where the vesicles go. Which cell organelle provides the instructions for these pr
    8·1 answer
  • What are organisms that make their own food called?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!