Explanation:
Agricultural productivity is dependent on Co2, Temperature, Solar Radiation, Precipitation, Soil Moisture and Wind Direction. Changes in any or all of these elements has a direct impact on the crop production
Answer:
You need to know the conditions required for natural selection to occur. These include: overproduction of offspring, inherited variation, and the struggle to survive, which result in differential reproductive success. You need to understand genetic drift and gene flow
Explanation:
Answer:
Genetic testing is useful in many areas of medicine and can change the medical care you or your family member receives. For example, genetic testing can provide a diagnosis for a genetic condition such as Fragile X or information about your risk to develop cancer. There are many different kinds of genetic tests
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
Answer:
The correct answer would be 2 in 4.
According to the question Xo and XO show codominance and express themselves completely when present in heterozygous condition. Cats bearing XoXO show patchwork of black and orange fur and are called tortoiseshell cats.
Xo codes for orange color fur and XO codes for black color fur. In addition, Y chromosome does not contain any gene associated with fur color.
Now, genotype of mother cat is XOXO (orange fur). So, the gametes formed would be XO only.
The genotype of father cat is XoY(black fur). So, the gametes would be Xo and Y.
The cross would lead to the formation of two male cats each having XOY as their genotype and two female cats each with XOXo as their genotype.
Hence, both the male cats would show orange fur and both the female cats would show patchwork of orange and black fur.
Therefore, we can conclude that 2 out of 4 would exhibit tortoiseshell coloring.