1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gnom [1K]
4 years ago
12

__________ is a mood disorder that is caused by the body's reaction to low levels of light present in the winter months

Biology
1 answer:
kati45 [8]4 years ago
3 0
I believe that the seasonal Affective disorder is a mood disorder that is caused by the body's reaction to low levels of light present in the winter months. People find they are only depressed at certain times of the year particularly winter months and goes away with onset of spring and summer. In this disorder people who have normal health through out most of the year exhibit depressive symptoms at the same time of the year especially in the winter. 
You might be interested in
List all wether
Sonja [21]

Explanation:

Agricultural productivity is dependent on Co2, Temperature, Solar Radiation, Precipitation, Soil Moisture and Wind Direction. Changes in any or all of these elements has a direct impact on the crop production

7 0
3 years ago
Which option describes a condition required for natural selection to occur?
Vika [28.1K]

Answer:

You need to know the conditions required for natural selection to occur. These include: overproduction of offspring, inherited variation, and the struggle to survive, which result in differential reproductive success. You need to understand genetic drift and gene flow

Explanation:

6 0
3 years ago
What’s an opinion you have about genetic testing?
Tresset [83]

Answer:

Genetic testing is useful in many areas of medicine and can change the medical care you or your family member receives. For example, genetic testing can provide a diagnosis for a genetic condition such as Fragile X or information about your risk to develop cancer. There are many different kinds of genetic tests

3 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Punnett squares are used to show possible combinations of alleles or to predict the probability of a trait occurring in offsprin
Andrei [34K]

Answer:

The correct answer would be 2 in 4.

According to the question Xo and XO show codominance and express themselves completely when present in heterozygous condition. Cats bearing XoXO show patchwork of black and orange fur and are called tortoiseshell cats.

Xo codes for orange color fur and XO codes for black color fur. In addition, Y chromosome does not contain any gene associated with fur color.

Now, genotype of mother cat is XOXO (orange fur). So, the gametes formed would be XO only.

The genotype of father cat is XoY(black fur). So, the gametes would be Xo and Y.

The cross would lead to the formation of two male cats each having XOY as their genotype and two female cats each with XOXo as their genotype.

Hence, both the male cats would show orange fur and both the female cats would show patchwork of orange and black fur.

Therefore, we can conclude that 2 out of 4 would exhibit tortoiseshell coloring.

3 0
3 years ago
Read 2 more answers
Other questions:
  • If a single mutation turns off the growth of some pairs of legs within an organism, what's most likely affected?
    10·1 answer
  • When these two species live in the same area they are apparently modifying their
    13·1 answer
  • Which of the following best describes evolution?
    13·1 answer
  • What is the difference between active &amp; passive transport?
    11·1 answer
  • What do plants do with most of the oxygen produced in photosynthesis?
    14·1 answer
  • What does a plant's large central vacuole hold?
    7·1 answer
  • Why do farmers plough their field during summer?
    11·1 answer
  • Which of the following characteristics are expected in the first animals to have colonized land?
    8·1 answer
  • A cell is the basic unit of structure and function in living organisms. What would you call an organism made up of many cells?
    7·1 answer
  • Sulfa drugs work on select one: a. nucleic acid biosynthesis. b. ribosome biosynthesis. c. peptidoglycan biosynthesis. d. folic
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!