Answer:
Complementary primer- 3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'
Explanation:
The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.
As per the base pair rule for DNA
Guanine binds to cytosine & vice versa
Adenine always binds to thymine & vice versa
Given Sequence - 5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'
Complementary primer- 3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'
Answer: Rabbits are small, furry, mammals with long ears, short fluffy tails, and strong, large hind legs. They have 2 pairs of sharp incisors (front teeth), one pair on top and one pair on the bottom.
Explanation: They are a type of animal
Breathing is the function of our body to let air flow to the lungs. It is important because it serves the purpose of bringing the amount of oxygen the body needs to work properly, and flushing out the toxic substances our body produces.
The diaphragm also plays its important role in respiratory system because it creates more space in our chest cavity, allowing the lungs to expand when we inhale.
The larynx connects the naso- and oro- pharynx with the trachea, functioning in air conduction, vocalisation and in obstructing passage of ingesta into the trachea during deglutition. The trachea divides into left and right mainstream bronchi. Bronchi give away to smaller conducting airways, bronchioles.
The walls of the alveoli share a membrane with the capillaries, this relatively lets the oxygen and carbon dioxide diffuse between the respiratory system and bloodstream. They bring oxygen into our body through inhalation and send carbon dioxide out called exhalation and overall process is respiration
Pneumonia is a life threatening illness because if our lungs is filled with fluid then they won’t be able to function normally and won’t be able to transfer enough oxygen to your blood or get rid of the carbon dioxide in our bloodstream
The sun has little or nothing to do with any of these answers except A. The sun gives plants energy, plants give animals energy, and animals give us energy. (Unless you're vegetarian in which case you skip the animal part)
Explanation:
In humans, each cell normally contains 23 pairs of chromosomes, for a total of 46. Twenty-two of these pairs, called autosomes, look the same in both males and females. The 23rd pair, the sex chromosomes, differ between males and females.