1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
umka2103 [35]
3 years ago
12

A weather station predicts that warm, humid air will pass over much cooler land during the early morning hours. Which precaution

should the weather station give to residents who are driving to work that morning? A.Bring extra water because the morning will be hot and dry. B.Use headlights and drive slowly if you encounter
dense fog. C.Pack raincoats and umbrellas to prepare for severe rainstorms. D. Plan for blizzard-like conditions by wearing snow boots and mittens.
Biology
2 answers:
Natasha2012 [34]3 years ago
8 0

When the air is humid it means that the air is already saturated with water vapor and that air is no longer capable of holding additional water vapor. This means that the next step should be precipitation (or rain, snow, etc). Therefore, the residents should be warn of the precipitation and be advised to bring protective devices such as umbrellas, raincoats, etc. 

 Read more on Brainly - brainly.com/sf/question/2812265
Angelina_Jolie [31]3 years ago
8 0

What is the ansewer of the question

You might be interested in
The conditions needed for primary
Neporo4naja [7]

Answer:

must happen before secondary succession

8 0
2 years ago
Read 2 more answers
Table salt is a compound that is made from an equal number of chlorine atoms and sodium atoms bonded together. Which of the foll
Liono4ka [1.6K]
Definitely D. Because we just learned about this in science
3 0
3 years ago
Read 2 more answers
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
what does the global conveyor belt reveal about the connectivity of water in the oceans? how could a change in the path of the g
skad [1K]
General paradigms of species extinction risk are urgently needed as global habitat loss and rapid climate change threaten Earth with what could be its sixth mass extinction. Using the stony coral Lophelia pertusa as a model organism with the potential for wide larval dispersal, we investigated how the global ocean conveyor drove an unprecedented post-glacial range expansion in Earth׳s largest biome, the deep sea. We compiled a unique ocean-scale dataset of published radiocarbon and uranium-series dates of fossil corals, the sedimentary protactinium–thorium record of Atlantic meridional overturning circulation (AMOC) strength, authigenic neodymium and lead isotopic ratios of circulation pathways, and coral biogeography, and integrated new Bayesian estimates of historic gene flow. Our compilation shows how the export of Southern Ocean and Mediterranean waters after the Younger Dryas 11.6 kyr ago simultaneously triggered two dispersal events in the western and eastern Atlantic respectively. Each pathway injected larvae from refugia into ocean currents powered by a re-invigorated AMOC that led to the fastest postglacial range expansion ever recorded, covering 7500 <span>km in under 400 years. In addition to its role in modulating global climate, our study illuminates how the ocean conveyor creates broad geographic ranges that lower extinction risk in the deep sea.</span>
8 0
2 years ago
Read 2 more answers
The phases of meiosis shown are out of order. Can you name of each of them?​ plz help me
Inga [223]
Prophase, metaphase, anaphase, and telophase.
7 0
3 years ago
Other questions:
  • If the stem of a plant is bent or snapped, why does the part above the bend usually die, even if it is propped up with a support
    8·1 answer
  • Naturally occurring substances found in plant foods that help prevent chronic diseases are
    8·1 answer
  • The kingdoms included in the linnaeus system of classification are
    6·1 answer
  • What do Silvia, tears, and nasal mucus have in common
    14·2 answers
  • which is not a basic function of a cell? A) storing energy B) releasing energy C) destroying energy D) obtaining energy
    9·1 answer
  • Although the outer mitochondrial membrane is permeable to all small molecules, the inner mitochondrial membrane is essentially i
    9·1 answer
  • Americans spend up to $100 billion annually for bottled water (41 billion gallons). The only beverages with higher sales are car
    13·1 answer
  • A plants epidermis contains many small openings called
    12·1 answer
  • What makes one DNA molecule different from another?
    15·1 answer
  • What element has fewer valence electrons than magnesium
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!