1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Drupady [299]
4 years ago
13

What is the structure of the rough ER?

Biology
1 answer:
Anni [7]4 years ago
4 0
It has ribosomes attached to it .
You might be interested in
All of the following cause mechanical weathering EXCEPT ____.
Elan Coil [88]
The answer is D.<span>carbonic acid </span>because that would be chemical weathering  
6 0
3 years ago
What is the complementary strand for this segment of DNA? ​I'll give u 15 point pls answer
Fittoniya [83]
I think it’s TACGTTTAACGAGTGGCCCTAGTCGTGGCC
8 0
4 years ago
Why do we need to cut our hair and finger nails?
Natali5045456 [20]
Because it is personal higuen
3 0
4 years ago
Read 2 more answers
The purpose of meiosis
Yuri [45]

Answer:

produce gametes, the sperm and eggs

Explanation:

Hope this helps :)

Pls mark brianliest :P

3 0
3 years ago
Read 2 more answers
All nematodes have an epidermal layer surrounded by a flexible, non-cellular layer called a _________________.
ozzi
 The answer here is a CUTICLE.

Cuticle is a multifunctional exoskeleton. It serves nematodes a variety of benefits. It aids in their locomotion via linkages to the body muscles as well as serve as  barrier from the environment. Uniquely, the flexible yet resilient, extracellular matrix is synthesized five times and contains collagen, insoluble proteins, glycoproteins and lipids.


5 0
3 years ago
Other questions:
  • Which term describes an inflammation of the tissue surrounding the heart?
    7·1 answer
  • Biology..please help..TYVM
    13·2 answers
  • Which statement is true about eukaryotic cells?
    11·1 answer
  • Describe how a new mRNA transcript is processed before it leaves the nucleus.
    7·1 answer
  • Plz tell<br> Vegetative characters of fungi
    13·1 answer
  • What is a system? And what is an ecosystem?
    10·1 answer
  • Question number one
    15·1 answer
  • Diffusion is a type of passive transport. Why?
    12·1 answer
  • Ur mom<br> Ur mom<br> Ur mom <br> Ur mom
    9·2 answers
  • Please answer!!<br> Why do molecules move? Explain concentration gradient.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!