1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tpy6a [65]
3 years ago
7

What is the complementary strand for this segment of DNA? ​I'll give u 15 point pls answer

Biology
1 answer:
Fittoniya [83]3 years ago
8 0
I think it’s TACGTTTAACGAGTGGCCCTAGTCGTGGCC
You might be interested in
Increased carbon in the oceans has caused the pH levels of the water to decrease. What is the largest impact of this ocean acidi
vitfil [10]
The answer is A as corals are very delicate to their surroundings 
3 0
3 years ago
Read 2 more answers
How can we make larger drawings ? Can someone tell me the guidelines please help
Zigmanuir [339]

Answer:

you should have skills of drawing observe the diagram

7 0
2 years ago
Read 2 more answers
An invasive species is an organism that’s not native to a particular ecosystem but ends up invading the region. The populations
denpristay [2]

An invasive species, such as the trees in your question, could:

- Out compete the native flora for resources, such as nutrients.

- An earlier reproductive and faster growing cycle could quickly surpass native tree growth.

- This alien species taking the place of native trees could disrupt the habitat of animal species that need the native flora instead.

4 0
3 years ago
When mucus collects in the tubes to the lungs it gives rise to an unpleasant rise. Name this.
anygoal [31]
That would be bronchitis.
8 0
2 years ago
What are the main processes involved in making proteins?
trasher [3.6K]

Answer:

translation and transcription

Explanation:

no. 1 is to do with energy in plants

no. 2 is cell reproduction

no. 3 is cell evolution

5 0
3 years ago
Other questions:
  • Blank is producing plants for beauty
    13·1 answer
  • Mr. jones is admitted to the nurse's unit from the emergency department with a diagnosis of hypocalcemia. his laboratory results
    15·1 answer
  • What term describes the behavior of an animal which warns another that a predator is approaching
    12·1 answer
  • Amylase is an enzyme found in saliva that helps break down starch in your mouth. In thischemical reaction, starch would be an ex
    5·1 answer
  • How do plates move relative to each other at convergent plate boundaries?
    10·1 answer
  • Francesco Redi disproved the idea of spontaneous generation through an experiment involving _____.
    13·1 answer
  • How can you determine the genotype of a plant that displays the dominant form of a trait?
    7·2 answers
  • Help please thanks This is for Science
    15·1 answer
  • The vertebrate digestive system consists of a two-way tube with
    7·1 answer
  • Which type of population growth is shown on this graph?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!