1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tpy6a [65]
3 years ago
7

What is the complementary strand for this segment of DNA? ​I'll give u 15 point pls answer

Biology
1 answer:
Fittoniya [83]3 years ago
8 0
I think it’s TACGTTTAACGAGTGGCCCTAGTCGTGGCC
You might be interested in
Mutations in two important cancer-critical genes, encoding p53 and Rb, respectively, are commonly found in cancers. What type of
yuradex [85]

Answer:

Germline mutations

Explanation:

Mutation in the cancer critical genes leads to the formation of stable mutant protein whose accumulation leads to the origin of cancer cells. Mutant p53 proteins not only lose their tumor suppressive activities (P53 gene is a tumor suppressive gene) but often gain additional oncogenic functions that allow for uncontrolled division of cells allowing increased growth and survival advantages. the same also goes for the retinoblastoma gene which is also a tumor suppressor gene that regulates cell division and other cellular activities. This mutations are usually inherited and can be transfered to their offspring.

4 0
3 years ago
What is created between 2 amino acids during translation? O DNA polymerase peptide bond Ohydrogen bond RNA polymerase​
Nuetrik [128]

Answer:

1st one is the answer

I think it's correct

6 0
3 years ago
This type of reproduction in plants is centered around the flower's ovum
Burka [1]

Answer:

sexual reproduction

Explanation:

The type of reproduction in which the ovum and the pollen of a flower fuse together is refer to as sexual reproduction.

<u>The ovum of a flower is equivalent to the female reproductive part while the pollen is equivalent to the male's reproductive part. During fertilization, the female reproductive part (the ovum) fuses with the male's reproductive part (the pollen) to produce a zygote.</u>

4 0
3 years ago
How have extinction events changed the system of the earth?
arsen [322]

Answer:

Explanation:The Carnian Pluvial Episode (Late Triassic) was a time of global to a major extinction event and might have been the trigger of the spectacular known delta system by area (1,000,000 km2) in Earth history.

5 0
2 years ago
a baker has created a new strain of yeast which contains no cytochrome c gene and no cytochrome c protein. this will affect what
Anna007 [38]

A baker has created a new strain of yeast which contains no cytochrome c gene and no cytochrome c protein. this will affect what the yeast strain can do to obtain energy. what will this yeast strain do more of compared to a normal strain

Will this new strain of yeast obtain more or less free energy from glucose in its growing medium?

Answer: Less because cytochrome c is key to the electron transport chain.

Explanation:

The Cytochrome c is an essential component of the electron transport chain. Without this there will be no oxidation and reduction of iron atom will take place which could convert the ferrous ions to ferric ions. Thus the entire process of electron transport chain and energy production in the form of ATP will be compromised. So, there will be no production of energy in the anaerobic fermentation by yeast.

8 0
2 years ago
Other questions:
  • 2. Complete the paragraph on freshwater ecosystems by using the following terms: merge, mountain streams, oxygen, plankton, plan
    9·1 answer
  • Explain why the size of your muscles is the is partly an acquired trait and partly dependent on DNA
    9·2 answers
  • When the settlers arrived in New England, many forests were turned into fields. Eventually, some fields were abandoned and then
    6·1 answer
  • What was the most important result of the meireki fire of 1567 in edo?
    8·1 answer
  • The immune system is the body's defense against disease. White blood cells, or lymphocytes, are one type of immune system cell.
    6·1 answer
  • What does bio-mimicry deal with
    12·1 answer
  • Choose one of the characteristics of life you have studied. explain in detail how cell organelles support this characteristic.
    10·1 answer
  • X + x =24 find the value of x​
    5·1 answer
  • Write the difference between Picture Plant, mushroom and dodder on the basis of stem, leaf and water requirement.
    7·1 answer
  • How does the shape of a nerve cell
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!