1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tpy6a [65]
4 years ago
7

What is the complementary strand for this segment of DNA? ​I'll give u 15 point pls answer

Biology
1 answer:
Fittoniya [83]4 years ago
8 0
I think it’s TACGTTTAACGAGTGGCCCTAGTCGTGGCC
You might be interested in
When something is frozen does it increase or decrease in density?
Phoenix [80]

Answer:

Water expands when it freezes making it less dense than the water from which it freezes. In fact, its volume is a little over 9% greater (or density ca.

7 0
3 years ago
Read 2 more answers
The mechanism by which the end product of a metabolic pathway inhibits an earlier step in the pathway is most precisely describe
defon

Answer:

The mecanism is termed as feedback inhibition.

Explanation:

In an enzyme catalyzed sequential reaction the end product of that reaction inhibits the activity of the activity of the enzyme catalyzing the ist step This type of  regulation is called Feed back regulation or feedback inhibition.

               The main function of human body is to maintain the homeostasis of the all the components it contains.When the end product of an ongoing enzyme catalzsed sequential reaction is produced in a high lebel at that time to maintain its own homeostatis that end product inhibits the functioning of the enzyme catalzsing the ist step of that biochemical reaction.

For Example Cytidine tri phosphate inhibits the activity of aspartate transcarbamoylase catalyzing the de novo biosynthesis pathway of pyrimidine metabolism.

3 0
4 years ago
True or false: intensity and duration of exercise directly affects blood-glucose levels, possibly leading to hypoglycemia.
Ray Of Light [21]
False it does not lead to that
4 0
3 years ago
For gas exchange to be efficient, the respiratory membrane must be ________.
-Dominant- [34]
The answer is 0.5 to 1 micrometer thick.
6 0
3 years ago
How did the explosion of the USS Maine in Havana Harbor in February of 1898 help lead to the annexation of Hawaii? A) As a resul
krok68 [10]

Answer:

By 1795, the warrior chief, Kamehameha the Great, had conquered most of the Hawaiian islands and established a monarchy. In the 1820s, American whalers, traders, and Christian missionaries began to visit and settle in the kingdom of Hawaii.

Although a small minority, the Americans in Hawaii soon owned much of the land, which they began to turn into large sugar-cane plantations. The native Hawaiian population dropped sharply due to smallpox and other diseases that came with the American immigrants. Needing more workers, the sugar planters imported Chinese and Japanese contract laborers who agreed to work on the plantations for a set period of time.

As their influence increased, the Americans became deeply involved with the government of the Hawaiian kings. In 1840, American advisors helped King Kamehameha III produce Hawaii's first written constitution.

By 1842, the United States had developed regular diplomatic relations with Hawaii and supported its status as an independent country. After King David Kalakaua ascended the throne in 1874, Hawaii and the United States signed a trade agreement lifting some restrictions on exporting Hawaiian sugar to the United States. In addition, this agreement permitted the United States to lease a naval station at Pearl Harbor.

Explanation:

3 0
3 years ago
Other questions:
  • One example of a very complex land ecosystem, full of thousands of kinds of living things
    5·1 answer
  • Some species of dolphins find their prey by echolocation; they emit clicking sounds and listen for echoes returning from distant
    13·1 answer
  • The tool most effective at monitoring the anaerobic conditions caused by sudden spikes in the population of algae in a lake is t
    5·1 answer
  • A physician is often able to detect homeostatic imbalances in the body by observing changes in the skin color.
    12·1 answer
  • What is biology and its branches?
    7·1 answer
  • Please Help!! Is this c or d?
    14·1 answer
  • If you could help me it would make my day a 100x better.
    13·2 answers
  • Answer
    10·1 answer
  • A.Bacteria and mold <br> B. deer <br> C.grasses <br> D.mountain lion <br> Please help
    13·1 answer
  • Whats the difference between the cell wall and the cell membrane in a plant cell?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!