1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tpy6a [65]
3 years ago
7

What is the complementary strand for this segment of DNA? ​I'll give u 15 point pls answer

Biology
1 answer:
Fittoniya [83]3 years ago
8 0
I think it’s TACGTTTAACGAGTGGCCCTAGTCGTGGCC
You might be interested in
Which organism is unicellular<br><br><br><br> Will mark brainliest if right
Inga [223]

Answer:

The image on the left is unicellular. Unicellular means to be made of one cell and the two on the right are multicellular, made of multiple cells.

8 0
3 years ago
Read 2 more answers
Which of the following is a character of a low pressure system
Lemur [1.5K]
The answer is A 
The air circulated in a clockwise direction in the northern hemisphere
4 0
3 years ago
Read 2 more answers
Which respiratory disease in which sufferers are often called "pink puffers," is characterized by enlarged alveoli, lung inflamm
vitfil [10]
The correct answer is emphysema.
This respiratory disease occurs when alveoli get enlarged, and thus cause chronic lung inflammation and later on lung fibrosis as well. This person then finds it extremely hard to breathe properly, as airways tend to collapse during expiration.
7 0
3 years ago
The plant cell wall
KonstantinChe [14]

B. is a protective structure made of cellulose fibrils

<h2><u>Mark as Brainliest</u></h2>
4 0
3 years ago
Does anyone know this this animal is. my Francis is a praying mantis but I’m not sure
Rashid [163]
It looks like a black praying mantis...

5 0
3 years ago
Read 2 more answers
Other questions:
  • Which list below describes the next steps of evaporated water through the water cycle?
    6·1 answer
  • How does a tornado form
    5·2 answers
  • in figure 34-1 structure F produces which of the following hormones when you're feeling stress about a big test
    12·1 answer
  • Chemical runoff from fields, oil spills, and erosion is the major source? A.Air pollution.
    12·2 answers
  • The only carbohydrate in the homemade fruit smoothie comes from naturally occurring sources of milk and fruit sugar. Use the "i"
    13·1 answer
  • In subduction zones, dense pieces of oceanic crust are pulled downward toward the mantle. Which of the following forces drives t
    8·2 answers
  • A particular region is experiencing a viral epidemic. Which of the following would increase the likelihood of the epidemic becom
    6·2 answers
  • ANSWER QUICK BEING TIMED WILL GIVE BRAINLEIST NEED ALL QUESTIONS ANSWERED
    13·1 answer
  • HELP
    12·1 answer
  • Producers, such as those that make the foods that are shown below, make glucose during the process of photosynthesis. Where in t
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!