1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tpy6a [65]
3 years ago
7

What is the complementary strand for this segment of DNA? ​I'll give u 15 point pls answer

Biology
1 answer:
Fittoniya [83]3 years ago
8 0
I think it’s TACGTTTAACGAGTGGCCCTAGTCGTGGCC
You might be interested in
When a therapist uses techniques from various types of therapy, the person is said to be using
kogti [31]

Answer:

An eclectic approach

Explanation:

An eclectic approach is an approach that combines multiple different approaches. In psychotherapy, an eclectic approach can be described as one that relies on multiple theoretical orientations and techniques. This allows the therapist to be flexible and use methods that best suit their client's individual needs.

5 0
2 years ago
Compare a diploid and haploid cell
raketka [301]
The main difference between haploid and diploid cells is the number of chromosome sets found in the nucleus. Diploid cells have two sets while haploid cells only contain one set.
5 0
3 years ago
Viruses acquire an envelope during the maturation step of a cell's viral infection?
Flura [38]
It depends on which virus you are referring to specifically. Viruses come in many shapes and types; their variations are tremendous.

For HIV and Influenza, viruses acquire their envelops after maturation, during the budding off or detachment stage from the host cell.

Hope this helps! :)
6 0
3 years ago
3
Alekssandra [29.7K]

Answer:

awts gegegegegegegegegegegege

8 0
3 years ago
Factors that affect rate of erosion
Tcecarenko [31]

Answer:

farm management, rainfall, climate, soil type, soil cover, landscape, type of wave, crops, rock strength and position of coast.

Explanation:

Erosion can be defined as a geological process which typically involves the wearing out of earthen (soil) materials and the transportation of these materials by natural forces like water, wind, etc. Soil erosion is greatest when the soil is steep.

The steepness of a body such as river or stream refers to the downward slope or gradient of the body of water.

Generally, the steepness of a body affects the rate at which other materials would flow or move around. Thus, the steeper a river or stream, the greater would be its rate of erosion.

Other factors that affect the rate of erosion in an area include the following; farm management, rainfall, climate, soil type, soil cover, landscape, type of wave, crops, rock strength and position of coast.

7 0
2 years ago
Other questions:
  • Organisms that use energy from the sun to make their own food are called
    13·2 answers
  • Can you live without a pancreas?
    15·2 answers
  • What is another word for volcanic? A. igneous B. plutonic C. extrusive D. crystallized
    12·2 answers
  • Why does geographic isolation cause speciation?
    12·1 answer
  • ONLY ONE ANSWER!!
    12·2 answers
  • What would a burning animal fiber smell like ?
    12·2 answers
  • The initial step in the formation of an aminoacyl-tRNA is Group of answer choices esterification of the tRNA activation of the t
    11·1 answer
  • What type pf response occurs when a person is infected by a bacteria​
    14·1 answer
  • If a sea urchin eats two sea weed and one sea grass, how many uts Hg does the sea urchin have?
    5·1 answer
  • Why stomata on the leaf are found down the leaf than the upper ​
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!