1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tpy6a [65]
4 years ago
7

What is the complementary strand for this segment of DNA? ​I'll give u 15 point pls answer

Biology
1 answer:
Fittoniya [83]4 years ago
8 0
I think it’s TACGTTTAACGAGTGGCCCTAGTCGTGGCC
You might be interested in
Sewage is the most common form of pollution in rivers and streams. Please select the best answer from the choices provided T F
timurjin [86]

Answer:

Its true

Explanation:

TRUTH SPEAKS

8 0
3 years ago
Diseña un procedimiento corto que te permita conocer qué tanto ayudan en la conservación de los ecosistemas las personas (máximo
Oksana_A [137]
Had do herbs dabbed can
6 0
3 years ago
The change that occurred in peppered moths is an example of
mojhsa [17]

Answer:

I think it's D, but it could be B.

Explanation:

5 0
4 years ago
Read 2 more answers
Select a type of renewable energy. Compare it to fossil fuels by explaining two pros and two cons for its implementation on a la
myrzilka [38]

Answer:

Bio gas

Explanation:

Bio gas is gotten from the anaerobic breaking down of biomass especially animal waste.

PROS:

A. it is renewable: biogas is renewable and has an endless supply of material since animals are the main source when compared to fossil fuels.

B. It doesn't involve a rigorous mining exersice to get to like fossil fuels and it is in accessible abundance.

CON:

A. A lot of waste is needed for the product of biogas and the final waste (sludge) from the production process can be a huge problem to dispose off.

B. Some of the gases liberated in the manufacturing process are greenhouse gas, especially methane. These gases if let out, will contribute immensly to global warming.

8 0
3 years ago
What is and exoskeleton and explain in full clear sentences please
LekaFEV [45]

An exoskeleton is the outer skeleton of an animal to protect them. An exoskelton is also called a shell.

7 0
3 years ago
Other questions:
  • How do the structures of alveoli and capillaries support the function of gas exchange?
    9·1 answer
  • Explain and illustrate how the long-term survival
    6·1 answer
  • if cellular respiration took place in just one step most of the ___ would be lost in the form of light and___
    7·1 answer
  • A plant grows faster and fuller due to large amounts of fertilizer. If the plant cross-pollinates with another plant later, how
    10·2 answers
  • How does convention occur in the troposphere
    5·2 answers
  • Nitrogen is an essential component for the growth of plants but they cannot take it
    10·1 answer
  • Contagious patients should enter the office from where
    9·1 answer
  • Brainlest if you do the ones i have not done
    14·1 answer
  • A boulder falls down the side of a cliff and smashes into many smaller pieces. Which destructive forces are working to break the
    12·1 answer
  • Eukaryotic cells do NOT have a cytoplasm true or false
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!