1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tpy6a [65]
3 years ago
7

What is the complementary strand for this segment of DNA? ​I'll give u 15 point pls answer

Biology
1 answer:
Fittoniya [83]3 years ago
8 0
I think it’s TACGTTTAACGAGTGGCCCTAGTCGTGGCC
You might be interested in
Describe how ocean temperatures affect the weather.
Kaylis [27]

Answer:

Ocean temperatures can cause large storms such as hurricanes or tropical storms. Warmer ocean waters create larger and stronger storms as well as keep said storms going longer. Warmer ocean waters can also cause the temperature in the immediate air around it to be slightly warmer.

Please give brainliest.

Explanation:

3 0
2 years ago
Which of the following is NOT a component of a virus? A. plasma membrane B. protein capsid C. nucleic acid D. tail section
Alexeev081 [22]
The answer is A:it does not have a plasma membrane. if you need proof https://www.bing.com/search?q=does%20a%20virus%20have%20a%20plasma%20membrane&qs=n&form=QBRE&sp=-1&p... i did a simple search

8 0
2 years ago
Read 2 more answers
.
Vladimir79 [104]

nearly perpendicular or closer to a 90˚ angle

4 0
3 years ago
What model shows the correct direction of flow of a rabies virus traveling through a neuron?
S_A_V [24]

Answer: Anterograde tracers

Explanation:

The anterograde traces can flow across a synapse from one neuron to another

3 0
2 years ago
It is difficult to make conclusions about scientific data collected from fossilized remains because the data
lisabon 2012 [21]

Answer: Fossils are rare because most remains are consumed or destroyed soon after death. Even if bones are buried, they then must remain buried and be replaced with minerals. If an animal is frozen like the baby mammoth mentioned above, again the animal must remain undisturbed for many years before found.

Explanation:

5 0
3 years ago
Other questions:
  • We need lots of energy to do the things we want to do: keep our houses warm, drive cars, run computers, grow and harvest food. T
    15·1 answer
  • A man is walking home alone late one night and is startled when a dog in a yard to his left barks unexpectedly. Respond to
    14·1 answer
  • 18 points+brainliest! please i need help with this
    6·1 answer
  • What type of RNA is a major component of the structure at which protein synthesis occurs?
    5·2 answers
  • Global phytoplankton levels
    12·1 answer
  • HELP ASAP ! QUESTION IS IN PICTURE !​
    5·1 answer
  • You examine an epithelial cell (skin cell) and notice the chromosomes are visible however it appears there are two nuclei in the
    6·1 answer
  • Complete each sentence regarding the bones of the lower extremity. Then place the sentences in order, based on the bones, from p
    6·1 answer
  • This is the type of succession that
    5·1 answer
  • Nterphase lasts for ________ of a cell's life.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!