1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tpy6a [65]
4 years ago
7

What is the complementary strand for this segment of DNA? ​I'll give u 15 point pls answer

Biology
1 answer:
Fittoniya [83]4 years ago
8 0
I think it’s TACGTTTAACGAGTGGCCCTAGTCGTGGCC
You might be interested in
What is the best example of strictly physical contamination of food?
kvasek [131]

Answer:

poison or sour food

Explanation:

I can't explain because I not intelligent enough to explain. I downloaded this app so I can improve more in my academic

7 0
2 years ago
Which feature is characteristic of estuaries?
Oksana_A [137]
1) Salinity- range from 0-35 ppt. 2) Tidal influence- From ocean, moves nutrients and wastes. 3) Fresh water- From land drainage, to creeks, to rivers or to bayous.
5 0
3 years ago
Which fact represents evidence for the big bang theory?(ONLY ONE ANSWER)
Annette [7]

Answer:srry but the big bang has been now proven wrong a false theory of what happened to start the earth...(And if you where wondering I am a Christian..) good luck with your questions... AND I BELIEVE YOUR ANSWER IS .D... YES IT IS .D.

3 0
3 years ago
After our solar system began to form, dust and gas combined into small bodies that formed the planets. What are these small bodi
Klio2033 [76]

Answer:

Planetesimals

Explanation:

8 0
3 years ago
Read 2 more answers
DNA and RNA are both.
denis23 [38]
DNA and RNA are both <span>molecules that contain genetic information and are made up of nucleotides. The answer to your question is B.</span>
5 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following would be considered a source of error in an Experiment
    14·2 answers
  • Explain the relationship between crossing over and genetic variation
    12·2 answers
  • Name the two phyla of multicellular algae.
    8·1 answer
  • Fungi called Deuteromycetes are not known to reproduce sexually. Nonetheless, most of them are considered members of the _______
    14·1 answer
  • What thaws slower land, air, or water
    5·1 answer
  • Who should the student label each circle in this digram
    13·1 answer
  • Which of the following steps is an important part of the process by which ecology guides humans to a sustainable future
    15·1 answer
  • Why is phytoplankton located near the ocean’s surface?
    8·2 answers
  • As cells increase in size, what happens to the amount of DNA the cells has?
    11·1 answer
  • Which of the following is an interaction in which one organism benefits and the other is unaffected?
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!