1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tpy6a [65]
3 years ago
7

What is the complementary strand for this segment of DNA? ​I'll give u 15 point pls answer

Biology
1 answer:
Fittoniya [83]3 years ago
8 0
I think it’s TACGTTTAACGAGTGGCCCTAGTCGTGGCC
You might be interested in
Which statement is an example of mutualism?
Ronch [10]

Mutualism is a relationship where both parties are benefited

B. Bees pollinate flowers while obtaining nectar.

The bees get nectar and the flowers get pollinated

Hope this helped!

~Just a girl in love with Shawn Mendes

7 0
3 years ago
In an aerosol can used for spray paint, a highly compressed "propellant" helps move the liquid into a "dip tube" so that it can
Degger [83]
<span>The liquid rise up through the dip tube when the valve is opened.  </span>The propellant gas wants to expand as much as it can, so if the valve is open, the propellant expands and pushes the spray up out of the can making more room for itself to expand.
7 0
3 years ago
Read 2 more answers
Which component of the circulatory system is at the tissue level?
Nadya [2.5K]

Blood is considered to be a tissue and it is part of the circulatory system.


The human circulatory system functions to transport blood and oxygen from the lungs to the various tissues of the body. The heart pumps the blood throughout the body. The lymphatic system is an extension of the human circulatory system that includes cell-mediated and antibody-mediated immune systems.



4 0
3 years ago
What are some possible solutions for managing tropical rainforests?
vichka [17]
You can restore damaged ecosystems by planting trees on land where forests have been cut down. Or you can encourage people around you to live in ways that don't hurt the environment.
6 0
3 years ago
Read 2 more answers
Protons have a positive charge, electrons have a negative charge, and neutrons have no change. Given
weqwewe [10]
B it needs to lose a neutron and a proton so that all parts of the atom are equal
7 0
3 years ago
Other questions:
  • Sandra wanted to test the effectiveness of various kitchen cleaners, so she performed the following experiment. First, she prepa
    9·2 answers
  • To transform bacteria with plasmids, technicians first make the bacteria competent (capable of taking up DNA) by placing them in
    12·1 answer
  • For women and men in the 19- to 50-year-old range, the calcium dri is _____ milligrams.​
    8·1 answer
  • What are two ways nonliving things could affect<br>yellow-rumped warblers?​
    9·1 answer
  • Compare the number of chromosomes in a human cell before and after it divides
    7·1 answer
  • What are toenails made of?
    15·2 answers
  • What is a charge that improves a species' change of survival?
    6·1 answer
  • Society expects scientists to follow ethical practices and meet many ethical standards. Which is an example of one of these ethi
    14·2 answers
  • Part 4- Discussion- Your response must be at least 8 sentences long. You must use complete sentences. How has science and techno
    6·1 answer
  • 29. Poison dart frogs are brightly colored to warn off predators. Which factor is most likely to cause male
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!