1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
arlik [135]
3 years ago
9

Evidence of a chemical change includes

Biology
2 answers:
adoni [48]3 years ago
8 0
Change in color is the answer
Alexeev081 [22]3 years ago
8 0

b) change in color.....

You might be interested in
Crater Lake in southern Oregon is not a crater but actually a ___.
hammer [34]

Answer: caldera

Explanation: shore length is not a well defined measure. crater lake is a crater lake in south central Oregon in the western united states. the lake only partly fills a nearly 2,148-foot deep caldera that was formed around 7,700 years ago by collapse of the volcano mount Mazama.

7 0
3 years ago
Read 2 more answers
Describe two ways of measuring biodiversity. Explain the relationship between biodiversity and ecosystem stability. As part of y
Daniel [21]

Answer:

- Two predictors to measure biodiversity: Species Richness and Simpson's Index  

- Biodiversity increases ecosystem stability  

- It has been shown that natural ecosystems are more stable than monocultures, while isolated human populations are found in highly diverse ecosystems

Explanation:

Two major predictors to measure biodiversity are: 1-species richness and the 2-Simpson's index. The species richness is a count for the total number of the species in a given habitat and/or ecosystem; while Simpson's index is a similarity index that indicates the likelihood that two different individuals selected at random from a sample will belong to the same species, thereby also estimating the biodiversity of a habit and/or ecosystem. Simpson's index takes into consideration the number of species and the abundance of each species. Ecosystems with high diversity tend to be more stable and resilient than ecosystems with low diversity. Biodiversity increases ecosystem stability due to the species asynchrony, which is a strong driver capable of stabilizing multiple processes/functions in the ecosystems over time (e.g., the productivity of the ecosystems over time). In this regard, it has been shown that forests that are highly diverse in the number of species are more productive and stable under stress than monocultures (i.e., agricultural crops), while isolated human populations live in sustainable ecosystems, it is for that reasons that isolated tribes are only found in highly diverse ecosystems.

5 0
3 years ago
Rising air makes clouds because the higher you go, the air gets ________ and cannot hold nearly as much water.
umka21 [38]
The answer is thinner. the air gets thinner :)
3 0
3 years ago
Get 20 points if you help on this question test ​
bija089 [108]

Answer:

I think it is both 1 and 2

Explanation:

6 0
3 years ago
which definition of the word waste has the most neutral connotation A spend unwisely B useless land C lose strength D unused par
Romashka [77]

Answer:

Explanation:

m

3 0
3 years ago
Other questions:
  • Approximately how old is the Earth
    14·2 answers
  • Which of these satisfies a basic need for a chipmunk? A. string B. burrow C. rocks D. highway
    5·1 answer
  • Where do the light reactions occur?
    11·2 answers
  • What determines how many covalent bonds two atoms can make?
    12·1 answer
  • Please help me on this one thank you
    5·1 answer
  • Organisms that have two different alleles for a trait are said to be
    9·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Plz help if you can added photo.
    12·1 answer
  • How is o2 cycle in Shenandoah national park?
    9·1 answer
  • Where is pryuvate made in the cell
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!