1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dimas [21]
3 years ago
9

Cellular respiration and fermentation both. . A. begin with the breakdown of glucose in glycolysis. . B.produce the same number

of ATP molecules. . C.only occur in animal cells. . D.require oxygen molecules as a reactant
Biology
2 answers:
Alexxx [7]3 years ago
5 0
Cellular respiration and fermentation both begin with the breakdown of glucose in glycolysis. The correct option among all the options that are given in the question is the first option or option "A". After the breakdown of glucose, energy and pyruvic acid is released. I hope the answer helps you.
Rus_ich [418]3 years ago
3 0

The correct answer is:

A. begin with the breakdown of glucose in glycolysis.

Explanation:

They both begin with a sequence of reactions known as glycolysis, which breaks glucose particles into smaller pyruvate molecules. They are also related in that through both processes, ATP is generated for the cell to use. Glycolysis is the metabolic pathway that transforms glucose C6H12O6, into pyruvate, CH3COCOO− + H+. The free energy delivered in this process is applied to form the high-energy molecules ATP and NADH .

You might be interested in
The inner layer of the skin is called the
BartSMP [9]
The epidermis is the 5 top layers, and the dermis is the 2 inner layers
5 0
2 years ago
FIRST ANSWER GETS 100 POINTS
Anastasy [175]
Receive deoxygenated blood from the body
4 0
3 years ago
Which objective lens should you start with when looking at a specimen?
MAXImum [283]
The highest power objective because you will see the specimen perfectly
6 0
3 years ago
All cells are surrounded by a cell membrane. Which statement is NOT an accurate description of a cell membrane? a Regulates what
Novosadov [1.4K]

Answer:

The correct answer is -  b. Responsible for the formation of ATP

Explanation:

The cell membrane is the outer membrane of all types of the cell including eukaryotic, and prokaryotic cell. The cell membrane surrounds the cytoplasm and cell organelles.

The cell membrane is made up of phospholipids that have a hydrophilic and hydrophobic region in the lipid bilayer. The main function of the cell membrane is to protect the cell, provide support, and regulation what enters and leaves the cell. ATP formation is not produced by the cell membrane.

4 0
2 years ago
How would you compare the distance of the moon from earth and the distance of the sun from earth
love history [14]

One of them is smaller, because the moon is much closer to earth than the sun.

Think of the moon orbiting the earth as a smaller version of the earth orbiting the sun.

8 0
3 years ago
Other questions:
  • if the male parent cell is heterozygous for a trait, Tt, what alleles could the sperm cells possibly have?
    12·1 answer
  • When a woman goes into labor during childbirth, the cervix expands which sends a signal to the pituitary gland to release oxytoc
    10·2 answers
  • What is the biological importance of the polarity of water?
    7·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • What is a particle with two or more atoms joined together
    7·1 answer
  • 30 POINTS!!!!!!!
    9·1 answer
  • How do the structure of adenine and
    14·1 answer
  • The cytoskeleton and extracellular matrix help to support the cell’s structure. The cytoskeleton can be compared to which of the
    8·1 answer
  • Which of the following describes how the amount of available energy changes from one trophic level to another? A) Available ener
    15·1 answer
  • Sometimes an organ can be replaced by moving it from one part of the body to another. This can be done, for example, to replace
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!