1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
balu736 [363]
3 years ago
6

Climates are defined by temperature and precipitation. true or false, answer in next minute

Biology
2 answers:
kari74 [83]3 years ago
7 0
True, temperature and precipitation affect the overall weather and climate of a place.
Serjik [45]3 years ago
5 0

Answer: True

Explanation:

Climate is defined by the temperature and precipitation. When climate is taken into consideration then the average of the temperature and precipitation is considered.

The other measures that affects the climate of the region is humidity, sunshine, fog, wind velocity.

Considering these factors for a longer duration of time over a year is defined as the climate of the region.

You might be interested in
This illustration shows a kind of animal that is a parasitic organism. What is the common name of this organism?
zhannawk [14.2K]
EW i believe its A though
7 0
3 years ago
Read 2 more answers
What is this? i need help and i’m struggling thank you so much <3
Sliva [168]

thats the plasma membrane. its the outside of a cell :)

hope that helped! <3

8 0
3 years ago
Wind can erode rocks, especially in desert areas. Select all the "spheres" that are interacting in this situation.
lidiya [134]
Erosion is brought about by the forces of nature or human activity: water, wind, earthquakes, mining, quarrying, etc. In the desert, there is very little water that can cause weathering or erosion, so the most probable answer is wind or maybe even animal activity.
6 0
3 years ago
There is only one possible path for each stage in the rock cycle.
grin007 [14]

Answer:

False

Hope this helps if not sorry

7 0
3 years ago
Read 2 more answers
I need help in class, I have one more to finish! Pls, help me, guys!
Ludmilka [50]

Answer:

If its dna replication: TTCATGCTATGCTACGTGTACGTACCGAT

If its transcription: UUCAYGCYAYGCYACGYGYACGYACCGAU

Explanation:

8 0
3 years ago
Other questions:
  • An earthquake creates a chasm that separates a population of squirrels. The two populations of squirrels evolve into two separat
    14·2 answers
  • List 4 types of carbohydrates
    14·1 answer
  • Describe the movement of substances in the sodium potassium pump
    6·2 answers
  • Can someone help me with all these questions
    15·1 answer
  • The size of a food chain can vary, but the number of levels that a food chain can reach is limited. Why does this limit exist ?
    7·1 answer
  • Give an example of a statement that best describes the rhyme scheme of "A Thought on the Inestimable Blessing of Reason".
    10·1 answer
  • How does mutation enable viruses to continue causing disease?
    13·1 answer
  • Which is one characteristic of deep ocean currents?
    15·2 answers
  • How does the shape of a nerve cell
    10·1 answer
  • Earth scientists have concluded that the methods of harnessing energy that have been used over the past tWO
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!