1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
scoray [572]
3 years ago
13

Which description best models the energy transfer that occurs in the radiative zone?

Biology
2 answers:
Tom [10]3 years ago
7 0
A ball is thrown by a player to a fan in the stands.
A baton is handed from one runner to the next, around a track.
A suitcase on a conveyor belt is moved from a plane to the baggage claim area.
A dropped wallet is kicked around the floor of a busy train station.
Kazeer [188]3 years ago
3 0

Answer:

the answer is D

Explanation:

just took the test and got it right.

You might be interested in
What is the main difference between weather and climate? A. Weather refers to temperature and precipitation, whereas climate ref
Nuetrik [128]

D. Weather refers to short-term conditions, whereas climate refers to long-term conditions. hope this helps!

8 0
3 years ago
What are tissues??<br>and what are cells?​
Slav-nsk [51]

Answer:

Tissues-

Tissue is a group of cells that have similar structure and that function together as a unit. A nonliving material, called the intercellular matrix, fills the spaces between the cells. This may be abundant in some tissues and minimal in others.

Cells-

Cells are the basic building blocks of all living things. The human body is composed of trillions of cells. They provide structure for the body, take in nutrients from food, convert those nutrients into energy, and carry out specialized functions.

Hope it helps dear Army ⟬⟭

Mark me as brainliest

if you find it helpful.

4 0
3 years ago
How many chromosomes do sugar gliders have?
Reil [10]
Two chromosomes is correct
8 0
2 years ago
Read 2 more answers
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
Early coal miners used canaries in cages as an early warning system to detect dangerous air
blagie [28]

Answer:

Because the Arctic glacier is crucial in cooling the land.

Explanation:

The glaciers contained in the Arctic are essential for cooling the earth's climate, which is why Arctic conditions are so important in determining the earth's climate changes.

These glaciers reflect about 80% of the sunlight in the northern hemisphere, and can cool the region's climate. If Arctic glaciers melt, most of the sun's rays will be absorbed by the ocean, increase the temperature and increase the melting of the glaciers.

As a result, the entire ecosystem will be damaged.

5 0
3 years ago
Other questions:
  • A population of 200 Mongolian gerbils living near Russia's Lake Baikal includes 80 brown gerbils with the AA genotype, 64 brown
    9·1 answer
  • "STx-producing bacteria cause over a million deaths a year, but treatment with antibiotics is not effective"
    10·1 answer
  • Which statement best describes the relationship of photosynthesis and energy?
    12·1 answer
  • Identify two activities that change the amount of CO2 in the atmosphere over time
    14·1 answer
  • Which factor of the genetic code makes organisms different from one another?
    9·2 answers
  • FAST!!! NEED HELP!
    11·2 answers
  • Cells Of the ____ divide Continuously and help in increasing the length and girth of plant
    10·1 answer
  • What format is typically followed with a hypothesis
    9·2 answers
  • The ________, which stains dark as it contains pigments and blood vessels, is just underneath the retina.
    10·1 answer
  • The chemoreceptors in blood vessels that sense oxygen and carbon dioxide levels in the blood are?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!