1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dedylja [7]
4 years ago
7

Hantavirus is a relatively rare emerging infectious disease that is spread in the feces and urine of rodents, such as deer mice.

It does not spread between people and causes flu-like symptoms. How would scientists most likely recommend that the disease be controlled?
Biology
2 answers:
Luda [366]4 years ago
8 0

Answer:

They would offer ways to control rodent populations.

Explanation:

Artist 52 [7]4 years ago
4 0

Answer:

Hantavirus pulmonary syndrome refers to a contagious disease featured by the flu-like signs, which can advance briskly to the possibly life-threatening inhalation issues. Many kinds of hantaviruses can lead to the syndrome. Many kinds of rodents can act as the vector for the virus, however, it is primarily caused by the deer mouse.  

One can get infected with the condition mainly by inhaling air infested with hantaviruses, which are shed in the droppings and urine of the rodent. The scientists can assist in controlling the condition by offering ways to monitor the population of rodents. As the treatment choices are confined, the best defense against the condition is to prevent rodents and their territories.  

You might be interested in
5’ATGCCCGGGTGTCGTAGTTGA3’<br><br> Complete the complementary sequence for the template strand.
dusya [7]

Answer for this question will be

3' TACGGGCCCACAGACTCAACT5', If the given strand is for RNA transcription than the complementary strand  will be 5'UACGGGCCCACAGCAUAACU 3'

8 0
3 years ago
(I need help will make brainlyest) Which shows the correct order for the classification of species------------------
yulyashka [42]
I believe the answer is B thank you troy and abed
8 0
3 years ago
How do I compare and contrast these?
My name is Ann [436]
Difference : shape, bone structure, dont have the same amount of fingers

Same: they all mock eachother with having some type of fingers
3 0
3 years ago
In Texas, a man showed up at a medical facility claiming that he felt drunk when he had not ingested any alcohol. Indeed his blo
blsea [12.9K]

Answer:

This condition might have arised due to  recent round of antibiotics that had killed the bacteria which live in his gut and had allowed a yeast species to grow.

Explanation:

Here, it is given:

  • Man when showed up at a medical facility felt drunk but he had not ingested any alcohol.
  • His blood alcohol has measured 0.37 which is many times a legal limit.
  • Also he claimed that he is home brewer and that intoxication showed is without any consumption of alcohol.

So, this condition can be hypothysed as the man may be on dosage of antibiotics. Whwn human body intakes an amount of antibiotics it kills the bacteria which is present in oue gut and allows an yeast formation to grow there.

So, this might be hypothysed from the given situation.

This condition of his can be changed by putting him on probiotics and by keeping him on a low carbohydrate diet for a week and then recheck for this alcohol consumption test.

Surely, this condition will improve.

5 0
4 years ago
A tall plant (TT) is crossed with a short plant (tt). What is the genotype?
neonofarm [45]

Answer: TT: 1/4; Tt: 2/4;tt: 1/4

Explanation:

The Punnett square is a diagram that is used in the predictions of genotypes. In this scenario, if we have a tall plant (TT) is crossed with a short plant (tt), after using the Punnett square, the genotype that we will get are as follows:.

TT, Tt, Tt, tt

Therefore, the correct option is option D "TT: 1/4; Tt: 2/4;tt: 1/4

6 0
3 years ago
Other questions:
  • Which statement describes the relationship between the deer and plants on the food web?
    13·1 answer
  • The syndrome called ____________ is characterized by confusion, disturbed concentration, and cognitive dysfunction. it has a sud
    6·1 answer
  • Why can’t you feel the force of attraction between you and mars
    10·1 answer
  • It is the study of the structure and function of plant and animal cells
    11·1 answer
  • The iodine test is positive for simple sugars if the substance turns bluish purple
    13·1 answer
  • How do I determine which band to cut out in agarose gel?
    15·1 answer
  • Please answer quick!
    15·1 answer
  • How many O2 molecules are required for two glucose molecules to undergo cellular respiration?
    7·2 answers
  • Compare and contrast the cell cycle with mitosis and the cell cycle with meiosis. Citing atleast 4 similarities and 5 difference
    12·1 answer
  • Which of these is not an organic waste found in urine?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!