Answer for this question will be
3' TACGGGCCCACAGACTCAACT5', If the given strand is for RNA transcription than the complementary strand will be 5'UACGGGCCCACAGCAUAACU 3'
I believe the answer is B thank you troy and abed
Difference : shape, bone structure, dont have the same amount of fingers
Same: they all mock eachother with having some type of fingers
Answer:
This condition might have arised due to recent round of antibiotics that had killed the bacteria which live in his gut and had allowed a yeast species to grow.
Explanation:
Here, it is given:
- Man when showed up at a medical facility felt drunk but he had not ingested any alcohol.
- His blood alcohol has measured 0.37 which is many times a legal limit.
- Also he claimed that he is home brewer and that intoxication showed is without any consumption of alcohol.
So, this condition can be hypothysed as the man may be on dosage of antibiotics. Whwn human body intakes an amount of antibiotics it kills the bacteria which is present in oue gut and allows an yeast formation to grow there.
So, this might be hypothysed from the given situation.
This condition of his can be changed by putting him on probiotics and by keeping him on a low carbohydrate diet for a week and then recheck for this alcohol consumption test.
Surely, this condition will improve.
Answer: TT: 1/4; Tt: 2/4;tt: 1/4
Explanation:
The Punnett square is a diagram that is used in the predictions of genotypes. In this scenario, if we have a tall plant (TT) is crossed with a short plant (tt), after using the Punnett square, the genotype that we will get are as follows:.
TT, Tt, Tt, tt
Therefore, the correct option is option D "TT: 1/4; Tt: 2/4;tt: 1/4