1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lisa [10]
4 years ago
8

______________ said there are no absolutes in the universe, except for the speed of light.

Biology
2 answers:
expeople1 [14]4 years ago
6 0
A. Einstein said there are no absolutes in the universe, except for the speed of light.
erma4kov [3.2K]4 years ago
3 0
<span>a. Einstein.. hope this helps you!!! =')</span>
You might be interested in
In humans, how many chromosomes are in each gamete after meiosis?
nydimaria [60]

15

If a cell has 15 pairs of chromosomes (n = 15), it has 30 chromosomes (2n = 30). At the

end of mitosis, the two daughter cells will be exact copies of the original cell. Each daughter

cell will have 30 chromosomes. At the end of meiosis II, each cell (i.e.,

6 0
3 years ago
Which is an indication that water is entering cells
MAVERICK [17]
The cell would become turgid or swollen, in plant cells, the cell wall prevents the cell from bursting whereas in animal cells, the cell would burst, if that makes any sense
4 0
3 years ago
Which of the following statements is true?
____ [38]
<span>0.3% of the Earth's water is fresh water. </span>
8 0
3 years ago
Read 2 more answers
Which if the following is required for viral reproduction? A) lysosomes. B) an aquatic environment. C) extreme temperatures. D)
elena55 [62]
I think it’s a living host cell so sorry if I’m wrong yw if I’m right
7 0
4 years ago
The mutation rates in Drosophila will most
zheka24 [161]

Answer: A. Ultraviolet Radiation

The mutation rates in drosophila will most likely increase after exposure to ultraviolet radiation.

Explanation:

Mutation are spontaneous random sudden changes that occur in the genetic makeup of an organism's. they are changes in the genetic sequence, and they are main cause of diversity among organism

Hope this helped!!!!

6 0
3 years ago
Other questions:
  • Describe a negative consequence of biotechnolofy
    13·1 answer
  • When true-breeding tall plants are crossed with hybrid tall plants,
    13·1 answer
  • Which of the following is not true about viruses
    8·2 answers
  • What is shown on the graph a) exponential decay of a population
    12·1 answer
  • 5’ATGCCCGGGTGTCGTAGTTGA3’<br><br> Complete the complementary sequence for the template strand.
    10·1 answer
  • What is the identity of planet A?<br> What is the identity of planet B?
    6·2 answers
  • In this figure, a line through points X and Y will
    12·1 answer
  • The primary source of energy for most cells is
    11·1 answer
  • A shepherd’s flock produces good wool, but the sheep are small and weak. The shepherd wants larger, stronger sheep that produce
    5·1 answer
  • Plants and animal cells have some of the same types of organelles. List these organelles, and explain why you think this is the
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!