1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Free_Kalibri [48]
3 years ago
14

_______________, harmful or helpful, is considered to be the source for new alleles and a main contributor to the diversity of l

ife on Earth.
Biology
2 answers:
leva [86]3 years ago
8 0
The answer is "mutation".

Hope this helps!

-Payshence xoxo

Volgvan3 years ago
5 0
Genetic mutation is considered to be the source for new alleles and a main contributor to the diversity of life on Earth.
You might be interested in
If 2 identical forces act on 2 different sized objects, the larger object will______ the smaller object.
yKpoI14uk [10]
It would accelerate less because it has a greater mass and it would require more force to move a more massive object.
3 0
3 years ago
Which term describes a progressive, degenerative liver disease?
Ivanshal [37]
<span>a progressive degenerative liver disease is cirrhosis</span>
6 0
3 years ago
Francis was recording plant heights for an experiment. Each time that she took a measurement, she wrote it down. Then,
Fittoniya [83]

Answer:

Form a conclusion

Explanation:

I believe this because they others don't make sense I'm sorry if it's in correct

8 0
4 years ago
Read 2 more answers
PLEASE HELP ME :(
scoray [572]
Sorry, it was easier to do it like it’s, hope you can read it! And hope it helps

6 0
3 years ago
A. One of the late symptoms of MN is excessive edema, or build up of fluid within the interstitial space of tissue. Explain how
antoniya [11.8K]

Answer:

Albumin is a protein that attracts water in the compartment where it is found, that is why when circulating within the blood vessels the blood volume is maintained by this protein, so that the liquid or fluid that makes up the blood volume is retained within the capillaries due to hydrostatic forces and because the albumin protein is hydrophilic.

The albumin is decreasing, that is, in deficit or hypoalbulinemia, less water reaches the blood compartment, therefore the blood pressure or pressure will drop, the blood volume will decrease but not due to loss of it as in hemorrhages, but due to diffusion to other compartments. VASCULAR through the processes of OSMOSIS, in simple words, when this protein descends, water filters from the blood vessels to extravascular compartments, this phenomenon clinically manifests itself as EDEMA.

Explanation:

Hypoalbulinemia also occurs in severe nutritional disorders where ovalbumine is not consumed through the egg, since the person's diet is severely lacking, generating massive edema in the abdominal area or abdominal distension.

The effect that the plasma liquid has in spreading to extravascular spaces is called OSMOSIS, which draws water from the external environment by the oncotic pressure generated by other proteins.

The oncotic pressure is the pressure that is generated when the water diffuses from one compartment to another by attraction of a protein, it happens both with albumin and with other proteins of the organism that are characterized by being hydrophilic or attracting water.

Hypoalbulinemia destroys severe cardiac symptoms due to the high demand that an increase in edema and difficulty of venous return entail along with the fall in blood pressure.

3 0
3 years ago
Other questions:
  • Why do we describe the information contained in the nucleus as hereditary
    14·1 answer
  • A 78-year-old woman is found unconscious on the floor of her Philadelphia apartment in August. The temperature outside is 102o F
    13·1 answer
  • If a daughter cell has 50 chromosomes after mitosis, how many chromosomes were in the parent cell?
    11·1 answer
  • Por qué razón se caliente el alambre al doblarlo repetidamente y por qué se rompe?
    11·1 answer
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • Which of the following represents the number of premolars in deciduous dentition of teeth in humans?
    7·1 answer
  • Boone with out marrow<br> A. long bone <br> B. short bone​
    12·2 answers
  • Describe adaptations in the circulatory and neurosensory systems of cephalopods that are particularly valuable for actively swim
    10·1 answer
  • What is the idea of devotion and loyalty to a country called that Africans
    7·1 answer
  • Explain briefly the forces that govern the upward movement of water and dissolved
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!