1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
klemol [59]
3 years ago
7

Light arriving at a concave mirror on a path through the focal point is reflected

Biology
1 answer:
Ivan3 years ago
8 0

Answer:

The correct answer is B

Explanation:

Because Thats how it works.

You might be interested in
Two groups of tomatoes were grown under laboratory conditions, one with humus added to the soil (Group 1) and the other a contro
charle [14.2K]

Answer:

the humus contains the minerals necessary for chlorophyll synthesis

Explanation:

<em>The yellowness of leaves in plants can be attributed to inadequate chlorophyll in the plant</em>. The chlorophyll is responsible for the greenness appearance of the leaves of plants and when it is present in inadequate quantity, the leaves appear yellowish in color.

<u>Some of the minerals necessary for the formation of chlorophyll include magnesium, nitrogen, and iron</u>. It thus means that the humus supplied to the soil of group 1 plant has the necessary minerals to synthesize chlorophyll while the soil of group 2 plants is deficient in some or all the minerals required for chlorophyll synthesis.

8 0
3 years ago
Why does water form large round drops as it falls from a faucet with a slow leak
jarptica [38.1K]
Water molecules are polar. This means that one end of the molecule is positively charged, while the other is negatively charged. Opposite charges attract. Water molecules on the faucet that are eventually pulled away from the others by gravity will themselves pull together and form round drops because the charged portions of molecule attract the oppositely charged portions of another.
8 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
The Milky Way a section of the universe smaller in size than our solar system, true or false
kakasveta [241]

Answer:

The answer is false, because our solar system exists inside the Milky Way.

Explanation:

3 0
3 years ago
Read 2 more answers
Analyze the situation illustrated in the graphic. Which would typically be the result of osmosis so that the cell may maintain h
bekas [8.4K]

i think the answer is B

7 0
3 years ago
Other questions:
  • Two true-breeding stocks of pea plants are crossed. One parent has red, axial flowers and the other has white, terminal flowers;
    15·1 answer
  • What are three inorganic components of soil
    11·1 answer
  • Which statement below is true? Group of answer choices Electron microscopes allow us to see true color of the specimen Only bact
    6·1 answer
  • Why did Gregor Mendel use peas in his experiments
    12·1 answer
  • Which is true for a substance in the gaseous phase?
    14·1 answer
  • How much of our body is made of muscle? What does this muscle do?
    11·2 answers
  • How is cancer related to the cell cycle?
    5·1 answer
  • Please help
    14·1 answer
  • Various sigma factors play a role in gene expression by.
    14·1 answer
  • Which of the bones in the collection Belongs to the axial skeleton
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!