Answer:
- B the kinds of molecules involved in the reaction
- C the kinds of elements that make up a molecule
- D whether the molecules are products or reactants
Explanation:
When modelling the chemical reaction, it is important that the process is explained such that people looking at the model understand what happened in terms of the reactants and products and how they came to be either.
Leann will therefore have to include the kinds of molecules involved in the reaction be they products or reactants. She will also have to include which elements make up the molecules for instance a water molecule would have the elements Hydrogen and Oxygen.
Finally she would have to indicate which molecules are reactant and which are products. Reactants usually stay to the left side of the reaction equation and products stay to the right.
Answer:
AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG
Explanation:
this is the complementary strand for the mRNA.
A=U
C=G
G=C
T=A
this is the key for any mRNA strand.
;)
The process of fertilization involves the deposition of sperms into the vagina to the egg cell during sexual intercourse. Sperms make their way towards the cervix and uterus, and eventually goes to the fallopian tubes. <span>Only a few hundred will remain as they interact with the egg through the use of their heads and movement patterns.
</span><span>The process of implantation happens when the embryo, the fertimized eggs develops inside the fallopian tube after three days, and then travels to the uterus.</span>
