1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
BaLLatris [955]
3 years ago
5

Which is an example of radiation?

Biology
2 answers:
neonofarm [45]3 years ago
7 0
The answer to the question is A.
enyata [817]3 years ago
5 0
I think the answer is A
You might be interested in
Need help with these asap
emmainna [20.7K]

I believe it goes in the following order top down

1 5 3 4 2.



5 0
3 years ago
Show how Australia gets more UV light than Brazil by drawing the path UV waves take through the different materials that make up
Afina-wow [57]

Explanation:

Solar UV radiation. Australia experiences some of the highest levels of UV radiation in the world because we are close to the equator and have many clear, blue-sky days. The Earth's orbit also brings countries in the southern hemisphere (Australia included) closer to the sun in the summertime than countries in the northern hemisphere during summer.

4 0
2 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
True or false?
jonny [76]

Answer:

true

Explanation:

hope this helps

stay safe

brainliest is appreciated i only need two more  to level up please help:))))

8 0
3 years ago
What are two bio-indicators that are intolerant?tolerant.
son4ous [18]
<span>Bio-indicators are macro-invertebrates that detect Water Quality based on how tolerant they are to pollution. The number of species of each type of Bio-indicator (pollution tolerant, intolerant, and semi-tolerant) will calculate the index of the water.</span>
3 0
3 years ago
Other questions:
  • _______ can produce their own energy.
    9·1 answer
  • Fossilized stromatolites
    6·1 answer
  • What is the fitness of an organism?
    13·1 answer
  • How to tell if a fossil is older
    15·1 answer
  • Why is East Ferris running out of water
    13·1 answer
  • Why does my (boys...)touch the water
    15·1 answer
  • The traits of an organism are largely determined by the traits of its parents. What do parents pass on to their offspring?
    10·1 answer
  • What are 3 examples of how enzymes work
    11·1 answer
  • Which of the following are NOT roles that zygomycota play in our ecosystem? Select all that apply.
    14·2 answers
  • 55.37
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!